BLASTN query output
BLASTN was ran against the database Ath_t2_s3+s5.2.
The query sequence was:
>C_gene
TTTAATAAAATAAAAATCCACTCGCATTTTTATTTTCAACATTGTGCGTA
CGGTGCAATTCAATGAACAGTGTTTACTTTCAGTGTGTACACTTCTGCGG
ACTATTACAAAGTCCACGTCTTATCCTACGTGTTATAATCTCATATGTTA
CTGTCTGAAATGGACCCCACTACGTAAAAATAAAATTAAGAATCAACCAC
TCTTCTTCCATCACCTCTTTTGGCTTTCTCTCTACTCTCTCTACTACTCT
CTCACCATCACTGAGTTAAGAGAACAAACCAAAAACAAAATTATCAAACC
ATCACCAGCAGAATCTTAGCTGGATTCATCACTCTATTCAAAAAGTTTCT
CTCTTCTCTTTTCTCAGATCTTGAACTCTTGAAGAAGAAAGAAGAAGATA
ACACAATGCTCTTCTTCTTATTCTTCTTCTACTTACTCTTATCTTCATCC
TCCGATCTAGTCTTCGCCGACCGTCGTGTACTCCACGAACCATTCTTCCC
TATAGATTCACCACCACCGTCACCACCATCACCACCACCACTTCCTAAAC
TACCATTCTCTTCAACCACTCCTCCATCTTCATCAGACCCAAATGCTTCT
CCTTTCTTCCCTTTATACCCTTCATCTCCACCACCACCTTCTCCAGCCTC
CTTCGCTTCTTTTCCGGCGAATATCTCATCTCTAATCGTCCCTCACGCCA
CTAAATCCCCACCTAACTCCAAAAAACTCCTTATCGTCGCTATCTCCGCC
GTTTCCTCCGCTGCTTTAGTCGCTCTACTTATCGCTTTACTCTATTGGCG
AAGAAGCAAACGTAACCAAGATCTTAACTTCTCCGATGATAGCAAAACAT
ACACCACCGACAGTAGCCGCCGTGTCTACCCTCCTCCTCCGGCAACGGCG
CCTCCAACACGACGCAATGCGGAGGCTAGAAGTAAACAGAGGACCACCAC
GAGCTCCACCAATAACAACAGCTCTGAGTTTCTTTACTTAGGAACAATGG
TGAATCAAAGAGGAATCGATGAACAATCTCTTAGTAATAATGGATCAAGC
TCAAGAAAACTTGAATCTCCAGATCTTCAACCACTTCCTCCATTGATGAA
ACGAAGTTTCCGTTTAAATCCAGATGTTGGTTCAATCGGAGAAGAAGATG
AAGAAGATGAGTTTTACTCTCCACGTGGCTCACAAAGCGGGCGAGAACCG
TTAAACCGGGTCGGACTTCCGGGTCAAAATCCTAGATCTGTTAACAATGA
CACTATCTCTTGCTCATCTTCAAGCTCTGGTTCACCAGGAAGATCAACAT
TTATCAGTATCTCTCCTTCAATGAGTCCTAAGAGATCTGAACCAAAACCG
CCGGTTATCTCCACACCAGAACCGGCGGAGTTAACCGATTATAGATTTGT
TCGGTCTCCGTCACTGTCGTTAGCTTCTTTATCGTCGGGATTGAAAAACT
CCGATGAAGTAGGATTGAATCAAATCTTTAGATCTCCGACGGTTACATCT
CTAACAACTTCACCGGAGAATAACAAAAAAGAGAACTCTCCATTATCATC
TACTTCAACTTCACCGGAACGACGACCAAATGATACACCAGAAGCTTACT
TGAGATCTCCGTCGCATTCTTCTGCTTCTACATCACCGTATAGATGTTTT
CAGAAATCTCCGGAGGTCTTACCGGCGTTTATGAGTAATCTCCGGCAAGG
TTTGCAATCTCAGTTACTATCTTCTCCTTCTAACTCTCATGGAGGACAAG
GTTTCCTTAAGCAGTTAGATGCATTACGTTCTCGTTCACCGTCGTCGTCT
TCTTCTTCTGTTTGTTCTTCACCGGAGAAAGCTTCTCATAAGTCACCAGT
TACATCTCCTAAGTTATCTTCCCGGAATTCGCAGTCTCTATCATCTTCTC
CGGATAGAGATTTTAGTCATAGCTTAGATGTATCACCACGGATATCGAAC
ATTTCACCTCAAATTTTACAGTCTCGTGTGCCTCCGCCTCCTCCTCCTCC
CCCACCGTTGCCGTTGTGGGGACGACGGAGTCAGGTGACTACTAAAGCGG
ACACAATCTCGAGACCGCCTTCTCTTACACCGCCTTCACATCCTTTTGTG
ATCCCATCTGAAAACTTACCAGTGACTTCGTCTCCTATGGAGACTCCAGA
GACGGTTTGTGCGAGTGAGGCGGCGGAGGAAACTCCGAAACCGAAGCTAA
AGGCGTTACATTGGGATAAAGTTAGAGCAAGTTCGGATCGTGAGATGGTT
TGGGATCATCTTCGATCAAGCTCTTTCAAGTGAGTTAATGTGACATACTC
GTTTATATGATACTATATGCTTTTAGTGAGAATGTGGTTGTTGAGATTAT
GAATGTGGTTTGCAGATTAGATGAGGAGATGATTGAGACGTTGTTTGTGG
CGAAGTCGTTAAACAACAAACCAAATCAGAGTCAGACAACTCCAAGATGT
GTTCTCCCGAGCCCGAACCAAGAGAACAGAGTCCTGGACCCGAAGAAGGC
TCAGAATATTGCCATCTTGCTTCGTGCACTTAATGTCACTATAGAAGAAG
TTTGTGAGGCTCTTCTTGAAGGTAAACTATGCTGTCACATACATAGTTTC
TCATTTTCTTCTCCTTTGATCTCCAGAATTAGAGTTCTTATGCATTTGTT
AATGGTTTTTCGATGATATGGTTGAGTTATTCTGAAAGCTTTGCTTCTTT
GATGGTGTGGAGATTCTTGGTTACATTGATGTTCTTAGTTATGCTTTTTC
AGGCAATGCTGATACACTGGGGACTGAACTTCTTGAGAGCTTACTGAAGA
TGGCACCGACAAAAGAAGAAGAGCGCAAGTTGAAAGCGTACAATGATGAT
TCGCCTGTTAAGCTTGGACATGCTGAGAAATTCCTTAAGGCAATGTTGGA
CATCCCTTTCGCCTTTAAAAGAGTTGATGCAATGCTCTATGTAGCCAACT
TTGAGTCCGAGGTTGAATACTTGAAGAAATCTTTTGAGACTCTTGAGGTA
TATATTACAAGCTATTCTCTCTCTTTTTACCATATGGTTGTATTGTAACA
GATTATGACTTCATTTCTATTGTTTGTGTAGGCTGCTTGTGAAGAACTGA
GGAACAGTAGGATGTTCTTAAAGCTTCTTGAAGCGGTTCTAAAGACAGGA
AACCGTATGAACGTTGGAACAAACCGAGGAGATGCACATGCGTTCAAGCT
TGATACACTTCTCAAGCTAGTCGATGTCAAAGGCGCTGATGGGAAAACAA
CTCTCTTGCATTTCGTTGTACAAGAGATAATCCGAGCAGAAGGCACACGT
CTCTCAGGTAACAATACACAAACAGATGACATTAAATGCCGGAAACTAGG
TCTCCAAGTTGTATCAAGTCTCTGTTCTGAGCTTAGTAACGTCAAGAAAG
CTGCTGCGATGGACTCAGAAGTACTAAGCAGCTACGTCTCCAAGCTTTCT
CAAGGCATTGCCAAGATCAACGAAGCAATCCAAGTCCAATCAACAATCAC
AGAAGAAAGCAACAGTCAGAGGTTTTCGGAATCGATGAAAACGTTTCTGA
AAAGAGCTGAGGAAGAGATCATCAGAGTACAAGCTCAAGAGAGCGTAGCG
TTATCACTTGTAAAAGAAATCACAGAGTATTTCCATGGAAACTCGGCTAA
AGAAGAAGCGCATCCGTTTAGAATATTCTTGGTGGTTAGAGACTTCCTTG
GAGTAGTAGACAGAGTTTGCAAAGAAGTAGGGATGATAAACGAAAGAACA
ATGGTTAGTTCTGCTCATAAGTTTCCTGTTCCAGTGAATCCAATGATGCC
ACAACCTCTTCCTGGACTCGTTGGACGAAGACAATCTTCTTCTTCTTCGT
CGTCGTCTTCAACCTCTTCGTCTGATGAAGACGAACATAACTCAATCTCA
TTAGTTTCTTAAGGTGAGATCTCAGCTTTGTCTGTGCATGTTGTTGTAAA
AAGTATCCAGTATTGGATTGTTTTGTCATAATAGATTTAAATATATATAT
ATAGAGGGAGGGAATTAATGACAGAAACAAAGAAGTGTTTTTCTTTTCTG
CATTTGTGTAAAAAAAATAATATAGGTTTACCTTAAAATTTGTTCATCTT
AAATTAATAATTTAAGAATCAAATAAATTTGTTTATCTGAACCGTGTGTA
CCACGAAAGAATGTGAGAGCAAACATATTACTTACTTACCCTTCGTTGCT
GAATATAATGATCATTATAAATCACTACCTCCAGTACCTTCTACCTTCTT
CAAAGAACCTTGTTGGATTTGAACCAAAGTTGGAACATAATTGACGAGAG
GTGAGCATCTAGATTCTGCATCGTGATGATGATCCACTTTTATCTATTTA
BLASTN 2.0.9 [May-07-1999]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= C_gene
(4350 letters)
Database: Ath_t2_s3+s5.2
40,423 sequences; 15,805,129 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
159O16T7 494 e-138
20461 371 e-101
14451 299 4e-80
33297 46 9e-04
157J7T7 46 9e-04
62466 44 0.003
227G24T7 44 0.003
470746 44 0.003
36F9T7 42 0.014
183P16T7 42 0.014
187H11T7 42 0.014
174D23T7 40 0.054
110K9T7 40 0.054
G11E5T7 40 0.054
190309 40 0.054
219K19T7 38 0.21
89F7XP 38 0.21
64B2T7 38 0.21
137I6T7 38 0.21
48A5T7 38 0.21
181304 38 0.21
303F8T7 38 0.21
203B19T7 38 0.21
SCF9T7P 38 0.21
G11A5T7 38 0.21
171I13T7 38 0.21
198N4T7 38 0.21
221D4T7 38 0.21
33709 38 0.21
133I5T7 38 0.21
110G16XP 38 0.21
158B2T7 38 0.21
178O7T7 38 0.21
108A19T7 38 0.21
141M13T7 38 0.21
F2H7T7 38 0.21
203B5T7 38 0.21
151N1XP 38 0.21
208I9T7 38 0.21
139M21T7 38 0.21
219K18T7 38 0.21
14551 38 0.21
88G21T7 38 0.21
H8C11T7 38 0.21
205E15T7 38 0.21
178N7T7 38 0.21
170P8T7 36 0.84
116L2XP 36 0.84
G12C5RTM 36 0.84
215K8T7 36 0.84
52652 36 0.84
185D14T7 36 0.84
33301 36 0.84
181316 36 0.84
118D8T7 36 0.84
186O8T7 36 0.84
218E22T7 36 0.84
13936 36 0.84
163E9XP 36 0.84
188I8XP 36 0.84
163B9T7 36 0.84
B75TP 36 0.84
219K22T7 36 0.84
127E13XP 36 0.84
229I5T7 36 0.84
246C6T7 36 0.84
133O8T7 36 0.84
98C14T7 36 0.84
122O1T7 36 0.84
157F4T7 36 0.84
178E19T7 36 0.84
215G22T7 36 0.84
157L22T7 36 0.84
92F23T7 36 0.84
183G24T7 36 0.84
183A9XP 36 0.84
161P6T7 36 0.84
187F24XP 36 0.84
G5B12T7 36 0.84
114J24XP 36 0.84
105B9T7 36 0.84
14468 36 0.84
111J7T7 36 0.84
131M21XP 36 0.84
226M4T7 36 0.84
40324 36 0.84
125N11T7 36 0.84
93I10XP 36 0.84
K3H10TP 36 0.84
209D19T7 36 0.84
82H7T7 34 3.3
K2G10RP 34 3.3
200I7T7 34 3.3
H8H11RTM 34 3.3
135H20XP 34 3.3
173P23T7 34 3.3
146P16T7 34 3.3
171O13T7 34 3.3
177J19T7 34 3.3
120O7T7A 34 3.3
291475 34 3.3
170D13T7 34 3.3
G11F5T7 34 3.3
205H16T7 34 3.3
173A24XP 34 3.3
E2G10T7 34 3.3
111A23T7 34 3.3
123C7T7 34 3.3
132J21XP 34 3.3
G5F7T7 34 3.3
151G18T7 34 3.3
63B1T7 34 3.3
121N4T7 34 3.3
SBD1T7P 34 3.3
246G8T7 34 3.3
213K19T7 34 3.3
223F20T7 34 3.3
247H21T7 34 3.3
14276 34 3.3
14342 34 3.3
46875 34 3.3
41A9T7 34 3.3
78F10T7 34 3.3
174N1T7 34 3.3
188E15T7 34 3.3
195J15T7 34 3.3
F1E3T7 34 3.3
106D22T7 34 3.3
170I7T7 34 3.3
174H24T7 34 3.3
229M24T7 34 3.3
78F10XP 34 3.3
230H6YTM 34 3.3
G11D11RTM 34 3.3
33673 34 3.3
221O2T7 34 3.3
G5A4T7 34 3.3
285H9T7 34 3.3
43645 34 3.3
117L10T7 34 3.3
153G15T7 34 3.3
123C1T7 34 3.3
161M7T7 34 3.3
G2D2T7 34 3.3
480917 34 3.3
144G16T7 34 3.3
146P6T7 34 3.3
119C9XP 34 3.3
G12G9RTM 34 3.3
116D4T7 34 3.3
163C7T7 34 3.3
192B23T7 34 3.3
288F11T7 34 3.3
211E7T7 34 3.3
G1A5T7 34 3.3
249H10T7 34 3.3
220B14T7 34 3.3
34G11T7 34 3.3
32C6T7 34 3.3
G12C4RTM 34 3.3
33344 34 3.3
470679 34 3.3
195E5T7 34 3.3
G9H5T7 34 3.3
122F16XP 34 3.3
152J1T7 34 3.3
154P15XP 34 3.3
153G14T7 34 3.3
124L6T7 34 3.3
46709 34 3.3
204D17T7 34 3.3
241I14T7 34 3.3
H3C1RTM 34 3.3
121G21T7 34 3.3
226O24T7 34 3.3
229N1T7 34 3.3
96C14T7 34 3.3
E10A10T7 34 3.3
179K16T7 34 3.3
221E5T7 34 3.3
46871 34 3.3
202K1T7 34 3.3
111M19T7 34 3.3
107F5T7 34 3.3
191G22T7 34 3.3
132H11XP 34 3.3
181154 34 3.3
186E12T7 34 3.3
>159O16T7
Length = 463
Score = 494 bits (249), Expect = e-138
Identities = 276/282 (97%), Gaps = 3/282 (1%)
Strand = Plus / Plus
Query: 3080 aggctgcttgtgaagaactgaggaacagtaggatgttcttaaagcttcttgaagcggttc 3139
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75 aggctgcttgtnaagaactgaggaacagtaggatgttcttaaagcttcttgaagcggttc 134
Query: 3140 taaagacaggaaaccgtatgaacgttggaacaaaccgaggagatgcacatgcgttcaagc 3199
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135 taaagacaggaaaccgtatgaacgttggaacaaaccgaggagatgcacatgcgttcaagc 194
Query: 3200 ttgatacacttctcaagctagtcgatgtcaaaggcgctgatgggaaaacaactctcttgc 3259
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 195 ttgatacacttctcaagctagtcgatgtcaaaggcgctgatgggaaaacaactctcttgc 254
Query: 3260 atttcgttgtacaagagataatccgagcagaaggcacacgtctct-caggtaacaataca 3318
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 255 atttcgttgtacaagagataatccgagcagaaggcacacgtctctccaggtaacaataca 314
Query: 3319 caaacagatgacattaaatgcc-ggaaacta-ggtctccaag 3358
||| ||| |||||||||||||| |||||||| ||||||||||
Sbjct: 315 caancagntgacattaaatgccgggaaactagggtctccaag 356
Score = 153 bits (77), Expect = 5e-36
Identities = 77/77 (100%)
Strand = Plus / Plus
Query: 2922 agttgatgcaatgctctatgtagccaactttgagtccgaggttgaatacttgaagaaatc 2981
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 agttgatgcaatgctctatgtagccaactttgagtccgaggttgaatacttgaagaaatc 60
Query: 2982 ttttgagactcttgagg 2998
|||||||||||||||||
Sbjct: 61 ttttgagactcttgagg 77
>20461
Length = 288
Score = 371 bits (187), Expect = e-101
Identities = 187/187 (100%)
Strand = Plus / Plus
Query: 2366 attagatgaggagatgattgagacgttgtttgtggcgaagtcgttaaacaacaaaccaaa 2425
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102 attagatgaggagatgattgagacgttgtttgtggcgaagtcgttaaacaacaaaccaaa 161
Query: 2426 tcagagtcagacaactccaagatgtgttctcccgagcccgaaccaagagaacagagtcct 2485
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 162 tcagagtcagacaactccaagatgtgttctcccgagcccgaaccaagagaacagagtcct 221
Query: 2486 ggacccgaagaaggctcagaatattgccatcttgcttcgtgcacttaatgtcactataga 2545
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 222 ggacccgaagaaggctcagaatattgccatcttgcttcgtgcacttaatgtcactataga 281
Query: 2546 agaagtt 2552
|||||||
Sbjct: 282 agaagtt 288
Score = 200 bits (101), Expect = 2e-50
Identities = 101/101 (100%)
Strand = Plus / Plus
Query: 2179 gaaactccgaaaccgaagctaaaggcgttacattgggataaagttagagcaagttcggat 2238
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 gaaactccgaaaccgaagctaaaggcgttacattgggataaagttagagcaagttcggat 60
Query: 2239 cgtgagatggtttgggatcatcttcgatcaagctctttcaa 2279
|||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 cgtgagatggtttgggatcatcttcgatcaagctctttcaa 101
>14451
Length = 287
Score = 299 bits (151), Expect = 4e-80
Identities = 164/167 (98%), Gaps = 1/167 (0%)
Strand = Plus / Plus
Query: 3824 gacgaagacaatcttcttcttcttcgtcgtcgtcttcaacctcttcgtctgatgaagacg 3883
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 18 gacgaagacaatcttcttcttcttcgtcgtcgtcttcaaccacttcgtctgatgaagacg 77
Query: 3884 aacataactcaatctcattagtttcttaaggtgagatctcagctttgtctgtgcatgttg 3943
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 78 aacataactcaatctcattagtttcttaaggtgagatctcagc-ttgtctgtgcatcttg 136
Query: 3944 ttgtaaaaagtatccagtattggattgttttgtcataatagatttaa 3990
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 ttgtaaaaagtatccagtattggattgttttgtcataatagatttaa 183
Score = 113 bits (57), Expect = 4e-24
Identities = 76/85 (89%)
Strand = Plus / Plus
Query: 4004 gagggagggaattaatgacagaaacaaagaagtgtttttcttttctgcatttgtgtnnnn 4063
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 197 gagggagggaattaatgacagaaacaaagaagtgtttttcttttctgcatttgagtaaaa 256
Query: 4064 nnnntaatataggtttaccttaaaa 4088
|||||||||||||||||||||
Sbjct: 257 aaaataatataggtttaccttaaaa 281
>33297
Length = 404
Score = 46.1 bits (23), Expect = 9e-04
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 3834 atcttcttcttcttcgtcgtcgtcttc 3860
||||||||||||||||||||| |||||
Sbjct: 145 atcttcttcttcttcgtcgtcatcttc 171
>157J7T7
Length = 408
Score = 46.1 bits (23), Expect = 9e-04
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 3834 atcttcttcttcttcgtcgtcgtcttc 3860
||||||||||||||||||||| |||||
Sbjct: 192 atcttcttcttcttcgtcgtcatcttc 166
>62466
Length = 296
Score = 44.1 bits (22), Expect = 0.003
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttctactt 434
||||||||||| ||||||||||||||
Sbjct: 87 ctcttcttcttcttcttcttctactt 112
>227G24T7
Length = 509
Score = 44.1 bits (22), Expect = 0.003
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 3835 tcttcttcttcttcgtcgtcgtcttc 3860
||||||||||||||||| ||||||||
Sbjct: 62 tcttcttcttcttcgtcttcgtcttc 87
>470746
Length = 306
Score = 44.1 bits (22), Expect = 0.003
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 3838 tcttcttcttcgtcgtcgtcttcaacctct 3867
||||||||||| ||||| ||||||||||||
Sbjct: 302 tcttcttcttcttcgtcttcttcaacctct 273
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3835 tcttcttcttcttcgtc 3851
|||||||||||||||||
Sbjct: 302 tcttcttcttcttcgtc 286
>36F9T7
Length = 400
Score = 42.1 bits (21), Expect = 0.014
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 3832 caatcttcttcttcttcgtcgtcgtcttc 3860
||||||||||||||||| || ||||||||
Sbjct: 148 caatcttcttcttcttcttcttcgtcttc 176
Score = 34.2 bits (17), Expect = 3.3
Identities = 23/25 (92%)
Strand = Plus / Plus
Query: 3835 tcttcttcttcttcgtcgtcgtctt 3859
|||||||||||||| ||||| ||||
Sbjct: 154 tcttcttcttcttcttcgtcttctt 178
>183P16T7
Length = 485
Score = 42.1 bits (21), Expect = 0.014
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 3832 caatcttcttcttcttcgtcgtcgtcttc 3860
||||||||||||||||| || ||||||||
Sbjct: 26 caatcttcttcttcttcttcttcgtcttc 54
Score = 34.2 bits (17), Expect = 3.3
Identities = 23/25 (92%)
Strand = Plus / Plus
Query: 3835 tcttcttcttcttcgtcgtcgtctt 3859
|||||||||||||| ||||| ||||
Sbjct: 32 tcttcttcttcttcttcgtcttctt 56
>187H11T7
Length = 562
Score = 42.1 bits (21), Expect = 0.014
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 3832 caatcttcttcttcttcgtcgtcgtcttc 3860
||||||||||||||||| || ||||||||
Sbjct: 47 caatcttcttcttcttcttcttcgtcttc 75
Score = 34.2 bits (17), Expect = 3.3
Identities = 23/25 (92%)
Strand = Plus / Plus
Query: 3835 tcttcttcttcttcgtcgtcgtctt 3859
|||||||||||||| ||||| ||||
Sbjct: 53 tcttcttcttcttcttcgtcttctt 77
>174D23T7
Length = 231
Score = 40.1 bits (20), Expect = 0.054
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1138 ggagaagaagatgaagaaga 1157
||||||||||||||||||||
Sbjct: 9 ggagaagaagatgaagaaga 28
>110K9T7
Length = 419
Score = 40.1 bits (20), Expect = 0.054
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1138 ggagaagaagatgaagaaga 1157
||||||||||||||||||||
Sbjct: 124 ggagaagaagatgaagaaga 143
>G11E5T7
Length = 525
Score = 40.1 bits (20), Expect = 0.054
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1138 ggagaagaagatgaagaaga 1157
||||||||||||||||||||
Sbjct: 60 ggagaagaagatgaagaaga 79
>190309
Length = 300
Score = 40.1 bits (20), Expect = 0.054
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 411 cttcttcttattcttcttctactt 434
||||||||| ||||||||||||||
Sbjct: 199 cttcttcttcttcttcttctactt 176
>219K19T7
Length = 558
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttcta 431
||||||||||| |||||||||||
Sbjct: 62 ctcttcttcttcttcttcttcta 40
>89F7XP
Length = 358
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatgagt 1162
||||||||| |||||||||||||
Sbjct: 316 agaagaagacgaagaagatgagt 338
Score = 34.2 bits (17), Expect = 3.3
Identities = 23/25 (92%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttctactt 434
||||| |||| ||||||||||||||
Sbjct: 330 tcttcgtcttcttcttcttctactt 306
>64B2T7
Length = 483
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
|||||||||| ||||||||||||
Sbjct: 104 aatcttcttcatcttcgtcgtcg 82
>137I6T7
Length = 235
Score = 38.2 bits (19), Expect = 0.21
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 1135 atcggagaagaagatgaagaag 1156
|||||||||||||||| |||||
Sbjct: 57 atcggagaagaagatgnagaag 36
>48A5T7
Length = 373
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatgagt 1162
|||||||||||||||||| ||||
Sbjct: 210 agaagaagatgaagaagaagagt 232
>181304
Length = 492
Score = 38.2 bits (19), Expect = 0.21
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 412 ttcttcttattcttcttct 430
|||||||||||||||||||
Sbjct: 309 ttcttcttattcttcttct 291
>303F8T7
Length = 444
Score = 38.2 bits (19), Expect = 0.21
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttctactta 435
||||||||||| |||||||||| ||||
Sbjct: 248 ctcttcttcttcttcttcttcttctta 274
>203B19T7
Length = 524
Score = 38.2 bits (19), Expect = 0.21
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1790 cgtcgtcgtcttcttcttc 1808
|||||||||||||||||||
Sbjct: 37 cgtcgtcgtcttcttcttc 19
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 10 gaagaagatgaagaaga 26
>SCF9T7P
Length = 420
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatgagt 1162
|||||||||||||||||| ||||
Sbjct: 199 agaagaagatgaagaagaagagt 221
>G11A5T7
Length = 588
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1138 ggagaagaagatgaagaagatga 1160
||||||||||| |||||||||||
Sbjct: 402 ggagaagaagaagaagaagatga 424
>171I13T7
Length = 466
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttcta 431
||||||||||| |||||||||||
Sbjct: 57 ctcttcttcttcttcttcttcta 35
>198N4T7
Length = 504
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatgagt 1162
|||||||||||||||||| ||||
Sbjct: 72 agaagaagatgaagaagaagagt 94
>221D4T7
Length = 463
Score = 38.2 bits (19), Expect = 0.21
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttctactta 435
||||||||||| |||||||||| ||||
Sbjct: 248 ctcttcttcttcttcttcttcttctta 274
>33709
Length = 333
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 410 tcttcttcttattcttcttctac 432
|||||||||| ||||||||||||
Sbjct: 170 tcttcttcttcttcttcttctac 192
>133I5T7
Length = 581
Score = 38.2 bits (19), Expect = 0.21
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttct 430
|||||||||||||||| |||||
Sbjct: 203 ctcttcttcttattctncttct 224
>110G16XP
Length = 280
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttcta 431
||||||||||| |||||||||||
Sbjct: 178 ctcttcttcttcttcttcttcta 156
>158B2T7
Length = 454
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatgagt 1162
|||||||||||||||||| ||||
Sbjct: 201 agaagaagatgaagaagaagagt 223
>178O7T7
Length = 539
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
|||||||||| ||||||||||||
Sbjct: 107 aatcttcttcatcttcgtcgtcg 85
>108A19T7
Length = 529
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatgagt 1162
|||||||||||||||||| ||||
Sbjct: 183 agaagaagatgaagaagaagagt 205
>141M13T7
Length = 498
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatgagt 1162
||||||||| |||||||||||||
Sbjct: 165 agaagaagacgaagaagatgagt 187
Score = 34.2 bits (17), Expect = 3.3
Identities = 23/25 (92%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttctactt 434
||||| |||| ||||||||||||||
Sbjct: 179 tcttcgtcttcttcttcttctactt 155
>F2H7T7
Length = 374
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttcta 431
||||||||||| |||||||||||
Sbjct: 214 ctcttcttcttcttcttcttcta 236
>203B5T7
Length = 461
Score = 38.2 bits (19), Expect = 0.21
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaagat 1158
|||||||||||||||||||
Sbjct: 19 agaagaagatgaagaagat 1
>151N1XP
Length = 564
Score = 38.2 bits (19), Expect = 0.21
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 412 ttcttcttattcttcttct 430
|||||||||||||||||||
Sbjct: 337 ttcttcttattcttcttct 319
>208I9T7
Length = 282
Score = 38.2 bits (19), Expect = 0.21
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 1135 atcggagaagaagatgaagaag 1156
|||||||||||||||| |||||
Sbjct: 57 atcggagaagaagatgnagaag 36
>139M21T7
Length = 440
Score = 38.2 bits (19), Expect = 0.21
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1790 cgtcgtcgtcttcttcttc 1808
|||||||||||||||||||
Sbjct: 145 cgtcgtcgtcttcttcttc 127
>219K18T7
Length = 573
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttcta 431
||||||||||| |||||||||||
Sbjct: 66 ctcttcttcttcttcttcttcta 44
>14551
Length = 180
Score = 38.2 bits (19), Expect = 0.21
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 412 ttcttcttattcttcttct 430
|||||||||||||||||||
Sbjct: 163 ttcttcttattcttcttct 145
>88G21T7
Length = 403
Score = 38.2 bits (19), Expect = 0.21
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 1790 cgtcgtcgtcttcttcttc 1808
|||||||||||||||||||
Sbjct: 367 cgtcgtcgtcttcttcttc 385
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 394 gaagaagatgaagaaga 378
>H8C11T7
Length = 620
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 408 gctcttcttcttattcttcttct 430
|||||||||||| ||||||||||
Sbjct: 257 gctcttcttcttcttcttcttct 279
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3835 tcttcttcttcttcgtc 3851
|||||||||||||||||
Sbjct: 271 tcttcttcttcttcgtc 287
>205E15T7
Length = 485
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
|||||||||| ||||||||||||
Sbjct: 138 aatcttcttcatcttcgtcgtcg 116
>178N7T7
Length = 490
Score = 38.2 bits (19), Expect = 0.21
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
|||||||||| ||||||||||||
Sbjct: 107 aatcttcttcatcttcgtcgtcg 85
>170P8T7
Length = 452
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 3835 tcttcttcttcttcgtcgtcgt 3856
||||||||||||||||| ||||
Sbjct: 237 tcttcttcttcttcgtcctcgt 216
>116L2XP
Length = 459
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 368 ctcttcttctttttcttcttct 347
>G12C5RTM
Length = 399
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaaga 1157
||||||||||||||||||
Sbjct: 241 agaagaagatgaagaaga 224
>215K8T7
Length = 476
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaaga 1157
||||||||||||||||||
Sbjct: 140 agaagaagatgaagaaga 157
>52652
Length = 306
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaaga 1157
||||||||||||||||||
Sbjct: 189 agaagaagatgaagaaga 206
>185D14T7
Length = 603
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 381 gaagaagaaagaagaaga 398
||||||||||||||||||
Sbjct: 44 gaagaagaaagaagaaga 27
>33301
Length = 398
Score = 36.2 bits (18), Expect = 0.84
Identities = 24/26 (92%)
Strand = Plus / Plus
Query: 1981 cctccgcctcctcctcctcccccacc 2006
||||| |||||||||||||| |||||
Sbjct: 227 cctccacctcctcctcctcctccacc 252
>181316
Length = 365
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 1798 tcttcttcttctgtttgttctt 1819
||||||||||||||| ||||||
Sbjct: 39 tcttcttcttctgttagttctt 60
>118D8T7
Length = 412
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttcta 431
|||||||||| |||||||||||
Sbjct: 45 tcttcttcttcttcttcttcta 24
>186O8T7
Length = 552
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttcta 431
|||||||||| |||||||||||
Sbjct: 120 tcttcttcttcttcttcttcta 99
>218E22T7
Length = 380
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 3 ctcttcttcttcttcttcttct 24
>13936
Length = 286
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 1798 tcttcttcttctgtttgttctt 1819
||||||||||||||| ||||||
Sbjct: 89 tcttcttcttctgttagttctt 110
>163E9XP
Length = 438
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 259 ctcttcttctttttcttcttct 238
>188I8XP
Length = 617
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttcta 431
|||||||||| |||||||||||
Sbjct: 354 tcttcttcttcttcttcttcta 333
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 364 ctcttcttcttcttcttcttct 343
>163B9T7
Length = 285
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 1141 gaagaagatgaagaagatgagt 1162
||||||||||||||||| ||||
Sbjct: 152 gaagaagatgaagaagaagagt 173
>B75TP
Length = 370
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 30 ctcttcttcttcttcttcttct 51
>219K22T7
Length = 541
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 47 ctcttcttcttcttcttcttct 26
>127E13XP
Length = 257
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 134 ctcttcttcttcttcttcttct 155
>229I5T7
Length = 551
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 50 ctcttcttcttcttcttcttct 29
>246C6T7
Length = 376
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaaga 1157
||||||||||||||||||
Sbjct: 90 agaagaagatgaagaaga 107
>133O8T7
Length = 549
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 381 gaagaagaaagaagaaga 398
||||||||||||||||||
Sbjct: 46 gaagaagaaagaagaaga 29
>98C14T7
Length = 552
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 40 ctcttcttcttcttcttcttct 61
>122O1T7
Length = 386
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 3838 tcttcttcttcgtcgtcgtctt 3859
||||||||||||||||| ||||
Sbjct: 188 tcttcttcttcgtcgtcctctt 167
>157F4T7
Length = 367
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1792 tcgtcgtcttcttcttct 1809
||||||||||||||||||
Sbjct: 84 tcgtcgtcttcttcttct 101
>178E19T7
Length = 230
Score = 36.2 bits (18), Expect = 0.84
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 410 tcttcttcttattcttcttct 430
|||||||||| ||||||||||
Sbjct: 23 tcttcttcttnttcttcttct 43
>215G22T7
Length = 264
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 3838 tcttcttcttcgtcgtcgtctt 3859
||||||||||||||||| ||||
Sbjct: 229 tcttcttcttcgtcgtcctctt 208
>157L22T7
Length = 460
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaaga 1157
||||||||||||||||||
Sbjct: 140 agaagaagatgaagaaga 157
>92F23T7
Length = 108
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttcta 431
|||||||||| |||||||||||
Sbjct: 89 tcttcttcttcttcttcttcta 68
>183G24T7
Length = 368
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1792 tcgtcgtcttcttcttct 1809
||||||||||||||||||
Sbjct: 30 tcgtcgtcttcttcttct 13
>183A9XP
Length = 561
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 410 tcttcttcttattcttcttcta 431
|||||||||| |||||||||||
Sbjct: 396 tcttcttcttcttcttcttcta 417
>161P6T7
Length = 444
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1981 cctccgcctcctcctcct 1998
||||||||||||||||||
Sbjct: 191 cctccgcctcctcctcct 174
>187F24XP
Length = 578
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 1979 tgcctccgcctcctcctcctcc 2000
|||| |||||||||||||||||
Sbjct: 208 tgccgccgcctcctcctcctcc 187
>G5B12T7
Length = 505
Score = 36.2 bits (18), Expect = 0.84
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 1798 tcttcttcttctgtttgttcttcacc 1823
|||||||||||| ||| |||||||||
Sbjct: 243 tcttcttcttcttttttttcttcacc 218
>114J24XP
Length = 424
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 169 ctcttcttcttcttcttcttct 190
>105B9T7
Length = 369
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaaga 1157
||||||||||||||||||
Sbjct: 180 agaagaagatgaagaaga 197
>14468
Length = 250
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttcta 431
|||||||||| |||||||||||
Sbjct: 55 tcttcttcttcttcttcttcta 34
>111J7T7
Length = 473
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaaga 1157
||||||||||||||||||
Sbjct: 187 agaagaagatgaagaaga 204
>131M21XP
Length = 411
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 195 ctcttcttcttcttcttcttct 174
>226M4T7
Length = 530
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 1984 ccgcctcctcctcctccc 2001
||||||||||||||||||
Sbjct: 13 ccgcctcctcctcctccc 30
>40324
Length = 344
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 410 tcttcttcttattcttct 427
||||||||||||||||||
Sbjct: 91 tcttcttcttattcttct 108
>125N11T7
Length = 389
Score = 36.2 bits (18), Expect = 0.84
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 3831 acaatcttcttcttcttc 3848
||||||||||||||||||
Sbjct: 88 acaatcttcttcttcttc 105
>93I10XP
Length = 563
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 1987 cctcctcctcctcccccaccgt 2008
|||||||||||| |||||||||
Sbjct: 94 cctcctcctccttccccaccgt 73
>K3H10TP
Length = 257
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttcta 431
|||||||||| |||||||||||
Sbjct: 46 tcttcttcttcttcttcttcta 25
>209D19T7
Length = 537
Score = 36.2 bits (18), Expect = 0.84
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttct 430
||||||||||| ||||||||||
Sbjct: 49 ctcttcttcttcttcttcttct 28
>82H7T7
Length = 584
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1134 aatcggagaagaagatg 1150
|||||||||||||||||
Sbjct: 16 aatcggagaagaagatg 32
>K2G10RP
Length = 572
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1476 ctttagatctccgacggttac 1496
||||||||| |||||||||||
Sbjct: 387 ctttagatcaccgacggttac 367
>200I7T7
Length = 383
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3838 tcttcttcttcgtcgtcgtct 3858
|||||||| ||||||||||||
Sbjct: 55 tcttcttcgtcgtcgtcgtct 75
>H8H11RTM
Length = 379
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||| |||||||||||
Sbjct: 272 agaagaagaagaagaagatga 292
>135H20XP
Length = 325
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 351 ctcttctcttttctcag 367
|||||||||||||||||
Sbjct: 71 ctcttctcttttctcag 55
>173P23T7
Length = 527
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 73 gaagaagatgaagaaga 57
>146P16T7
Length = 443
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 380 tgaagaagaaagaagaa 396
|||||||||||||||||
Sbjct: 251 tgaagaagaaagaagaa 235
>171O13T7
Length = 433
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 372 tgaactcttgaagaaga 388
|||||||||||||||||
Sbjct: 263 tgaactcttgaagaaga 279
>177J19T7
Length = 433
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 411 cttcttcttattcttcttcta 431
||||||||| |||||||||||
Sbjct: 25 cttcttcttcttcttcttcta 5
>120O7T7A
Length = 359
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||| |||||||||||
Sbjct: 49 agaagaagaagaagaagatga 29
>291475
Length = 371
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3804 acctcttcctggactcg 3820
|||||||||||||||||
Sbjct: 3 acctcttcctggactcg 19
>170D13T7
Length = 431
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1987 cctcctcctcctcccccaccg 2007
|||||||||||||| ||||||
Sbjct: 311 cctcctcctcctccgccaccg 291
>G11F5T7
Length = 529
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 348 tctctcttctcttttct 364
|||||||||||||||||
Sbjct: 118 tctctcttctcttttct 102
>205H16T7
Length = 425
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaagatgag 1161
|||||||| ||||||||||||
Sbjct: 41 gaagaagaagaagaagatgag 21
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3834 atcttcttcttcttcgtcgtc 3854
||||||||||||||| |||||
Sbjct: 24 atcttcttcttcttcttcgtc 44
>173A24XP
Length = 425
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1463 gattgaatcaaatcttt 1479
|||||||||||||||||
Sbjct: 328 gattgaatcaaatcttt 344
>E2G10T7
Length = 600
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 410 tcttcttcttattcttcttct 430
|||||||||| ||||||||||
Sbjct: 344 tcttcttcttcttcttcttct 324
>111A23T7
Length = 476
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaag 1156
|||||||||||||||||
Sbjct: 24 agaagaagatgaagaag 8
>123C7T7
Length = 381
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 411 cttcttcttattcttcttcta 431
||||||||| |||||||||||
Sbjct: 33 cttcttcttcttcttcttcta 13
>132J21XP
Length = 553
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 266 ttaagagaacaaaccaaaaac 286
||||||||||||| |||||||
Sbjct: 489 ttaagagaacaaaacaaaaac 469
>G5F7T7
Length = 531
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 2772 gactgaacttcttgaga 2788
|||||||||||||||||
Sbjct: 270 gactgaacttcttgaga 254
>151G18T7
Length = 476
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 2331 aatgtggttgttgagat 2347
|||||||||||||||||
Sbjct: 238 aatgtggttgttgagat 254
>63B1T7
Length = 468
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3015 ttctctctctttttacc 3031
|||||||||||||||||
Sbjct: 59 ttctctctctttttacc 75
>121N4T7
Length = 491
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 20 gaagaagatgaagaaga 4
>SBD1T7P
Length = 491
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 1141 gaagaagatgaagaagatgag 1161
|||||||||||||| ||||||
Sbjct: 286 gaagaagatgaagatgatgag 306
>246G8T7
Length = 268
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1829 aagcttctcataagtca 1845
|||||||||||||||||
Sbjct: 122 aagcttctcataagtca 106
>213K19T7
Length = 552
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 954 ctccaccaataacaaca 970
|||||||||||||||||
Sbjct: 324 ctccaccaataacaaca 308
>223F20T7
Length = 552
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 954 ctccaccaataacaaca 970
|||||||||||||||||
Sbjct: 81 ctccaccaataacaaca 97
>247H21T7
Length = 472
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttc 429
||||||||||| |||||||||
Sbjct: 21 ctcttcttcttcttcttcttc 1
>14276
Length = 778
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaagatgag 1161
|||||||| ||||||||||||
Sbjct: 41 gaagaagaagaagaagatgag 21
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3834 atcttcttcttcttcgtcgtc 3854
||||||||||||||| |||||
Sbjct: 24 atcttcttcttcttcttcgtc 44
>14342
Length = 250
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 954 ctccaccaataacaaca 970
|||||||||||||||||
Sbjct: 128 ctccaccaataacaaca 112
>46875
Length = 291
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 411 cttcttcttattcttct 427
|||||||||||||||||
Sbjct: 108 cttcttcttattcttct 92
>41A9T7
Length = 243
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 381 gaagaagaaagaagaagataa 401
||||||| |||||||||||||
Sbjct: 34 gaagaaggaagaagaagataa 54
>78F10T7
Length = 412
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 323 gaagaagatgaagaaga 307
>174N1T7
Length = 473
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 954 ctccaccaataacaaca 970
|||||||||||||||||
Sbjct: 308 ctccaccaataacaaca 292
>188E15T7
Length = 237
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 409 ctcttcttcttattcttcttc 429
||||||||||| |||||||||
Sbjct: 86 ctcttcttcttcttcttcttc 66
>195J15T7
Length = 412
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1987 cctcctcctcctccccc 2003
|||||||||||||||||
Sbjct: 146 cctcctcctcctccccc 130
>F1E3T7
Length = 530
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 954 ctccaccaataacaaca 970
|||||||||||||||||
Sbjct: 108 ctccaccaataacaaca 92
>106D22T7
Length = 498
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 411 cttcttcttattcttcttcta 431
||||||||| |||||||||||
Sbjct: 29 cttcttcttcttcttcttcta 9
>170I7T7
Length = 538
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttc 429
||||||||||| |||||||||
Sbjct: 3 ctcttcttcttcttcttcttc 23
>174H24T7
Length = 510
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||| |||||||||||
Sbjct: 113 agaagaagaagaagaagatga 93
>229M24T7
Length = 534
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaagatgag 1161
|||||||| ||||||||||||
Sbjct: 33 gaagaagaagaagaagatgag 13
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3834 atcttcttcttcttcgtcgtc 3854
||||||||||||||| |||||
Sbjct: 16 atcttcttcttcttcttcgtc 36
>78F10XP
Length = 510
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 210 gaagaagatgaagaaga 194
>230H6YTM
Length = 397
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1 tttaataaaataaaaat 17
|||||||||||||||||
Sbjct: 258 tttaataaaataaaaat 242
>G11D11RTM
Length = 389
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3835 tcttcttcttcttcgtc 3851
|||||||||||||||||
Sbjct: 265 tcttcttcttcttcgtc 249
>33673
Length = 331
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||||| |||||||||
Sbjct: 111 agaagaagatggagaagatga 91
>221O2T7
Length = 384
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 411 cttcttcttattcttcttcta 431
||||||||| |||||||||||
Sbjct: 26 cttcttcttcttcttcttcta 6
>G5A4T7
Length = 446
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3833 aatcttcttcttcttcg 3849
|||||||||||||||||
Sbjct: 222 aatcttcttcttcttcg 206
>285H9T7
Length = 559
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1829 aagcttctcataagtca 1845
|||||||||||||||||
Sbjct: 370 aagcttctcataagtca 354
>43645
Length = 337
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 2331 aatgtggttgttgagat 2347
|||||||||||||||||
Sbjct: 32 aatgtggttgttgagat 48
>117L10T7
Length = 502
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1829 aagcttctcataagtca 1845
|||||||||||||||||
Sbjct: 233 aagcttctcataagtca 217
>153G15T7
Length = 352
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3836 cttcttcttcttcgtcg 3852
|||||||||||||||||
Sbjct: 93 cttcttcttcttcgtcg 109
>123C1T7
Length = 423
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1980 gcctccgcctcctcctcctcc 2000
|||||| ||||||||||||||
Sbjct: 259 gcctcctcctcctcctcctcc 239
>161M7T7
Length = 437
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaag 1156
|||||||||||||||||
Sbjct: 27 agaagaagatgaagaag 11
>G2D2T7
Length = 466
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3833 aatcttcttcttcttcg 3849
|||||||||||||||||
Sbjct: 222 aatcttcttcttcttcg 206
>480917
Length = 214
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 266 ttaagagaacaaaccaaaaac 286
||||||||||||| |||||||
Sbjct: 75 ttaagagaacaaaacaaaaac 95
>144G16T7
Length = 375
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1137 cggagaagaagatgaagaaga 1157
|||||||||||| ||||||||
Sbjct: 244 cggagaagaagaagaagaaga 224
>146P6T7
Length = 464
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 4210 gatcattataaatcact 4226
|||||||||||||||||
Sbjct: 170 gatcattataaatcact 154
>119C9XP
Length = 568
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 266 ttaagagaacaaaccaaaaac 286
||||||||||||| |||||||
Sbjct: 551 ttaagagaacaaaacaaaaac 531
>G12G9RTM
Length = 396
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 416 tcttattcttcttctacttac 436
|||| ||||||||||||||||
Sbjct: 229 tcttcttcttcttctacttac 209
>116D4T7
Length = 428
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3835 tcttcttcttcttcgtc 3851
|||||||||||||||||
Sbjct: 231 tcttcttcttcttcgtc 247
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttc 429
||||||||||| |||||||||
Sbjct: 224 ctcttcttcttcttcttcttc 244
>163C7T7
Length = 524
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||| |||||||||||
Sbjct: 32 agaagaagaagaagaagatga 12
>192B23T7
Length = 430
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttc 429
||||||||||| |||||||||
Sbjct: 7 ctcttcttcttcttcttcttc 27
>288F11T7
Length = 603
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 63 gaagaagatgaagaaga 47
>211E7T7
Length = 465
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 321 gaagaagatgaagaaga 305
>G1A5T7
Length = 475
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 379 ttgaagaagaaagaagaagat 399
|||||||||||||| ||||||
Sbjct: 28 ttgaagaagaaagacgaagat 8
>249H10T7
Length = 328
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3835 tcttcttcttcttcgtc 3851
|||||||||||||||||
Sbjct: 25 tcttcttcttcttcgtc 9
>220B14T7
Length = 535
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||| |||||||||||
Sbjct: 36 agaagaagaagaagaagatga 56
>34G11T7
Length = 400
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 382 aagaagaaagaagaaga 398
|||||||||||||||||
Sbjct: 44 aagaagaaagaagaaga 60
>32C6T7
Length = 400
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 409 ctcttcttcttattcttcttc 429
||||||||||| |||||||||
Sbjct: 40 ctcttcttcttcttcttcttc 60
>G12C4RTM
Length = 373
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 381 gaagaagaaagaagaagataa 401
||||||||| |||||||||||
Sbjct: 220 gaagaagaaggaagaagataa 240
>33344
Length = 333
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 1794 gtcgtcttcttcttctg 1810
|||||||||||||||||
Sbjct: 307 gtcgtcttcttcttctg 323
>470679
Length = 310
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3832 caatcttcttcttcttc 3848
|||||||||||||||||
Sbjct: 263 caatcttcttcttcttc 279
>195E5T7
Length = 618
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1829 aagcttctcataagtca 1845
|||||||||||||||||
Sbjct: 212 aagcttctcataagtca 196
>G9H5T7
Length = 436
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 416 tcttattcttcttctacttac 436
|||| ||||||||||||||||
Sbjct: 172 tcttcttcttcttctacttac 192
>122F16XP
Length = 404
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1 tttaataaaataaaaat 17
|||||||||||||||||
Sbjct: 388 tttaataaaataaaaat 372
>152J1T7
Length = 486
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 381 gaagaagaaagaagaagataa 401
||||||||| |||||||||||
Sbjct: 279 gaagaagaaggaagaagataa 299
>154P15XP
Length = 485
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 347 ttctctcttctcttttc 363
|||||||||||||||||
Sbjct: 292 ttctctcttctcttttc 276
>153G14T7
Length = 454
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3836 cttcttcttcttcgtcg 3852
|||||||||||||||||
Sbjct: 93 cttcttcttcttcgtcg 109
>124L6T7
Length = 536
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 954 ctccaccaataacaaca 970
|||||||||||||||||
Sbjct: 71 ctccaccaataacaaca 87
>46709
Length = 405
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3833 aatcttcttcttcttcg 3849
|||||||||||||||||
Sbjct: 253 aatcttcttcttcttcg 237
>204D17T7
Length = 491
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||||||||| |||||
Sbjct: 153 agaagaagatgaagatgatga 173
>241I14T7
Length = 553
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 2331 aatgtggttgttgagat 2347
|||||||||||||||||
Sbjct: 217 aatgtggttgttgagat 233
>H3C1RTM
Length = 353
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3842 cttcttcgtcgtcgtct 3858
|||||||||||||||||
Sbjct: 273 cttcttcgtcgtcgtct 289
>121G21T7
Length = 372
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1144 gaagatgaagaagatga 1160
|||||||||||||||||
Sbjct: 120 gaagatgaagaagatga 104
>226O24T7
Length = 451
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1137 cggagaagaagatgaagaaga 1157
|||||||||||| ||||||||
Sbjct: 250 cggagaagaagaagaagaaga 230
>229N1T7
Length = 362
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaagatgag 1161
|||||||| ||||||||||||
Sbjct: 33 gaagaagaagaagaagatgag 13
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3834 atcttcttcttcttcgtcgtc 3854
||||||||||||||| |||||
Sbjct: 16 atcttcttcttcttcttcgtc 36
>96C14T7
Length = 480
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3835 tcttcttcttcttcgtc 3851
|||||||||||||||||
Sbjct: 26 tcttcttcttcttcgtc 10
>E10A10T7
Length = 608
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 372 tgaactcttgaagaaga 388
|||||||||||||||||
Sbjct: 100 tgaactcttgaagaaga 116
>179K16T7
Length = 441
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3804 acctcttcctggactcg 3820
|||||||||||||||||
Sbjct: 265 acctcttcctggactcg 281
>221E5T7
Length = 516
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 3835 tcttcttcttcttcgtc 3851
|||||||||||||||||
Sbjct: 188 tcttcttcttcttcgtc 204
>46871
Length = 325
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||| |||||||||||
Sbjct: 190 agaagaagaagaagaagatga 170
>202K1T7
Length = 480
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1140 agaagaagatgaagaagatga 1160
||||||||| |||||||||||
Sbjct: 49 agaagaagaagaagaagatga 29
>111M19T7
Length = 491
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 2331 aatgtggttgttgagat 2347
|||||||||||||||||
Sbjct: 199 aatgtggttgttgagat 215
>107F5T7
Length = 534
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 76 gaagaagatgaagaaga 60
>191G22T7
Length = 536
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaaga 1157
|||||||||||||||||
Sbjct: 83 gaagaagatgaagaaga 67
>132H11XP
Length = 393
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 381 gaagaagaaagaagaagataa 401
||||||||| |||||||||||
Sbjct: 203 gaagaagaaggaagaagataa 223
>181154
Length = 417
Score = 34.2 bits (17), Expect = 3.3
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1800 ttcttcttctgtttgtt 1816
|||||||||||||||||
Sbjct: 126 ttcttcttctgtttgtt 110
>186E12T7
Length = 490
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 1141 gaagaagatgaagaagatgag 1161
|||||||| ||||||||||||
Sbjct: 53 gaagaagaagaagaagatgag 33
Score = 34.2 bits (17), Expect = 3.3
Identities = 20/21 (95%)
Strand = Plus / Plus
Query: 3834 atcttcttcttcttcgtcgtc 3854
||||||||||||||| |||||
Sbjct: 36 atcttcttcttcttcttcgtc 56
Database: Ath_t2_s3+s5.2
Posted date: Nov 12, 1999 9:46 AM
Number of letters in database: 15,805,129
Number of sequences in database: 40,423
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 71844
Number of Sequences: 40423
Number of extensions: 71844
Number of successful extensions: 8060
Number of sequences better than 10.0: 249
length of query: 4350
length of database: 15,805,129
effective HSP length: 18
effective length of query: 4332
effective length of database: 15077515
effective search space: 65315794980
effective search space used: 65315794980
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)