BLASTN query output

BLASTN was ran against the database Ath_t2_s3+s5.2. The query sequence was:

>C_gene
TTTAATAAAATAAAAATCCACTCGCATTTTTATTTTCAACATTGTGCGTA
CGGTGCAATTCAATGAACAGTGTTTACTTTCAGTGTGTACACTTCTGCGG
ACTATTACAAAGTCCACGTCTTATCCTACGTGTTATAATCTCATATGTTA
CTGTCTGAAATGGACCCCACTACGTAAAAATAAAATTAAGAATCAACCAC
TCTTCTTCCATCACCTCTTTTGGCTTTCTCTCTACTCTCTCTACTACTCT
CTCACCATCACTGAGTTAAGAGAACAAACCAAAAACAAAATTATCAAACC
ATCACCAGCAGAATCTTAGCTGGATTCATCACTCTATTCAAAAAGTTTCT
CTCTTCTCTTTTCTCAGATCTTGAACTCTTGAAGAAGAAAGAAGAAGATA
ACACAATGCTCTTCTTCTTATTCTTCTTCTACTTACTCTTATCTTCATCC
TCCGATCTAGTCTTCGCCGACCGTCGTGTACTCCACGAACCATTCTTCCC
TATAGATTCACCACCACCGTCACCACCATCACCACCACCACTTCCTAAAC
TACCATTCTCTTCAACCACTCCTCCATCTTCATCAGACCCAAATGCTTCT
CCTTTCTTCCCTTTATACCCTTCATCTCCACCACCACCTTCTCCAGCCTC
CTTCGCTTCTTTTCCGGCGAATATCTCATCTCTAATCGTCCCTCACGCCA
CTAAATCCCCACCTAACTCCAAAAAACTCCTTATCGTCGCTATCTCCGCC
GTTTCCTCCGCTGCTTTAGTCGCTCTACTTATCGCTTTACTCTATTGGCG
AAGAAGCAAACGTAACCAAGATCTTAACTTCTCCGATGATAGCAAAACAT
ACACCACCGACAGTAGCCGCCGTGTCTACCCTCCTCCTCCGGCAACGGCG
CCTCCAACACGACGCAATGCGGAGGCTAGAAGTAAACAGAGGACCACCAC
GAGCTCCACCAATAACAACAGCTCTGAGTTTCTTTACTTAGGAACAATGG
TGAATCAAAGAGGAATCGATGAACAATCTCTTAGTAATAATGGATCAAGC
TCAAGAAAACTTGAATCTCCAGATCTTCAACCACTTCCTCCATTGATGAA
ACGAAGTTTCCGTTTAAATCCAGATGTTGGTTCAATCGGAGAAGAAGATG
AAGAAGATGAGTTTTACTCTCCACGTGGCTCACAAAGCGGGCGAGAACCG
TTAAACCGGGTCGGACTTCCGGGTCAAAATCCTAGATCTGTTAACAATGA
CACTATCTCTTGCTCATCTTCAAGCTCTGGTTCACCAGGAAGATCAACAT
TTATCAGTATCTCTCCTTCAATGAGTCCTAAGAGATCTGAACCAAAACCG
CCGGTTATCTCCACACCAGAACCGGCGGAGTTAACCGATTATAGATTTGT
TCGGTCTCCGTCACTGTCGTTAGCTTCTTTATCGTCGGGATTGAAAAACT
CCGATGAAGTAGGATTGAATCAAATCTTTAGATCTCCGACGGTTACATCT
CTAACAACTTCACCGGAGAATAACAAAAAAGAGAACTCTCCATTATCATC
TACTTCAACTTCACCGGAACGACGACCAAATGATACACCAGAAGCTTACT
TGAGATCTCCGTCGCATTCTTCTGCTTCTACATCACCGTATAGATGTTTT
CAGAAATCTCCGGAGGTCTTACCGGCGTTTATGAGTAATCTCCGGCAAGG
TTTGCAATCTCAGTTACTATCTTCTCCTTCTAACTCTCATGGAGGACAAG
GTTTCCTTAAGCAGTTAGATGCATTACGTTCTCGTTCACCGTCGTCGTCT
TCTTCTTCTGTTTGTTCTTCACCGGAGAAAGCTTCTCATAAGTCACCAGT
TACATCTCCTAAGTTATCTTCCCGGAATTCGCAGTCTCTATCATCTTCTC
CGGATAGAGATTTTAGTCATAGCTTAGATGTATCACCACGGATATCGAAC
ATTTCACCTCAAATTTTACAGTCTCGTGTGCCTCCGCCTCCTCCTCCTCC
CCCACCGTTGCCGTTGTGGGGACGACGGAGTCAGGTGACTACTAAAGCGG
ACACAATCTCGAGACCGCCTTCTCTTACACCGCCTTCACATCCTTTTGTG
ATCCCATCTGAAAACTTACCAGTGACTTCGTCTCCTATGGAGACTCCAGA
GACGGTTTGTGCGAGTGAGGCGGCGGAGGAAACTCCGAAACCGAAGCTAA
AGGCGTTACATTGGGATAAAGTTAGAGCAAGTTCGGATCGTGAGATGGTT
TGGGATCATCTTCGATCAAGCTCTTTCAAGTGAGTTAATGTGACATACTC
GTTTATATGATACTATATGCTTTTAGTGAGAATGTGGTTGTTGAGATTAT
GAATGTGGTTTGCAGATTAGATGAGGAGATGATTGAGACGTTGTTTGTGG
CGAAGTCGTTAAACAACAAACCAAATCAGAGTCAGACAACTCCAAGATGT
GTTCTCCCGAGCCCGAACCAAGAGAACAGAGTCCTGGACCCGAAGAAGGC
TCAGAATATTGCCATCTTGCTTCGTGCACTTAATGTCACTATAGAAGAAG
TTTGTGAGGCTCTTCTTGAAGGTAAACTATGCTGTCACATACATAGTTTC
TCATTTTCTTCTCCTTTGATCTCCAGAATTAGAGTTCTTATGCATTTGTT
AATGGTTTTTCGATGATATGGTTGAGTTATTCTGAAAGCTTTGCTTCTTT
GATGGTGTGGAGATTCTTGGTTACATTGATGTTCTTAGTTATGCTTTTTC
AGGCAATGCTGATACACTGGGGACTGAACTTCTTGAGAGCTTACTGAAGA
TGGCACCGACAAAAGAAGAAGAGCGCAAGTTGAAAGCGTACAATGATGAT
TCGCCTGTTAAGCTTGGACATGCTGAGAAATTCCTTAAGGCAATGTTGGA
CATCCCTTTCGCCTTTAAAAGAGTTGATGCAATGCTCTATGTAGCCAACT
TTGAGTCCGAGGTTGAATACTTGAAGAAATCTTTTGAGACTCTTGAGGTA
TATATTACAAGCTATTCTCTCTCTTTTTACCATATGGTTGTATTGTAACA
GATTATGACTTCATTTCTATTGTTTGTGTAGGCTGCTTGTGAAGAACTGA
GGAACAGTAGGATGTTCTTAAAGCTTCTTGAAGCGGTTCTAAAGACAGGA
AACCGTATGAACGTTGGAACAAACCGAGGAGATGCACATGCGTTCAAGCT
TGATACACTTCTCAAGCTAGTCGATGTCAAAGGCGCTGATGGGAAAACAA
CTCTCTTGCATTTCGTTGTACAAGAGATAATCCGAGCAGAAGGCACACGT
CTCTCAGGTAACAATACACAAACAGATGACATTAAATGCCGGAAACTAGG
TCTCCAAGTTGTATCAAGTCTCTGTTCTGAGCTTAGTAACGTCAAGAAAG
CTGCTGCGATGGACTCAGAAGTACTAAGCAGCTACGTCTCCAAGCTTTCT
CAAGGCATTGCCAAGATCAACGAAGCAATCCAAGTCCAATCAACAATCAC
AGAAGAAAGCAACAGTCAGAGGTTTTCGGAATCGATGAAAACGTTTCTGA
AAAGAGCTGAGGAAGAGATCATCAGAGTACAAGCTCAAGAGAGCGTAGCG
TTATCACTTGTAAAAGAAATCACAGAGTATTTCCATGGAAACTCGGCTAA
AGAAGAAGCGCATCCGTTTAGAATATTCTTGGTGGTTAGAGACTTCCTTG
GAGTAGTAGACAGAGTTTGCAAAGAAGTAGGGATGATAAACGAAAGAACA
ATGGTTAGTTCTGCTCATAAGTTTCCTGTTCCAGTGAATCCAATGATGCC
ACAACCTCTTCCTGGACTCGTTGGACGAAGACAATCTTCTTCTTCTTCGT
CGTCGTCTTCAACCTCTTCGTCTGATGAAGACGAACATAACTCAATCTCA
TTAGTTTCTTAAGGTGAGATCTCAGCTTTGTCTGTGCATGTTGTTGTAAA
AAGTATCCAGTATTGGATTGTTTTGTCATAATAGATTTAAATATATATAT
ATAGAGGGAGGGAATTAATGACAGAAACAAAGAAGTGTTTTTCTTTTCTG
CATTTGTGTAAAAAAAATAATATAGGTTTACCTTAAAATTTGTTCATCTT
AAATTAATAATTTAAGAATCAAATAAATTTGTTTATCTGAACCGTGTGTA
CCACGAAAGAATGTGAGAGCAAACATATTACTTACTTACCCTTCGTTGCT
GAATATAATGATCATTATAAATCACTACCTCCAGTACCTTCTACCTTCTT
CAAAGAACCTTGTTGGATTTGAACCAAAGTTGGAACATAATTGACGAGAG
GTGAGCATCTAGATTCTGCATCGTGATGATGATCCACTTTTATCTATTTA


BLASTN 2.0.9 [May-07-1999]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= C_gene
         (4350 letters)

Database: Ath_t2_s3+s5.2
           40,423 sequences; 15,805,129 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

159O16T7                                                             494  e-138
20461                                                                371  e-101
14451                                                                299  4e-80
33297                                                                 46  9e-04
157J7T7                                                               46  9e-04
62466                                                                 44  0.003
227G24T7                                                              44  0.003
470746                                                                44  0.003
36F9T7                                                                42  0.014
183P16T7                                                              42  0.014
187H11T7                                                              42  0.014
174D23T7                                                              40  0.054
110K9T7                                                               40  0.054
G11E5T7                                                               40  0.054
190309                                                                40  0.054
219K19T7                                                              38  0.21
89F7XP                                                                38  0.21
64B2T7                                                                38  0.21
137I6T7                                                               38  0.21
48A5T7                                                                38  0.21
181304                                                                38  0.21
303F8T7                                                               38  0.21
203B19T7                                                              38  0.21
SCF9T7P                                                               38  0.21
G11A5T7                                                               38  0.21
171I13T7                                                              38  0.21
198N4T7                                                               38  0.21
221D4T7                                                               38  0.21
33709                                                                 38  0.21
133I5T7                                                               38  0.21
110G16XP                                                              38  0.21
158B2T7                                                               38  0.21
178O7T7                                                               38  0.21
108A19T7                                                              38  0.21
141M13T7                                                              38  0.21
F2H7T7                                                                38  0.21
203B5T7                                                               38  0.21
151N1XP                                                               38  0.21
208I9T7                                                               38  0.21
139M21T7                                                              38  0.21
219K18T7                                                              38  0.21
14551                                                                 38  0.21
88G21T7                                                               38  0.21
H8C11T7                                                               38  0.21
205E15T7                                                              38  0.21
178N7T7                                                               38  0.21
170P8T7                                                               36  0.84
116L2XP                                                               36  0.84
G12C5RTM                                                              36  0.84
215K8T7                                                               36  0.84
52652                                                                 36  0.84
185D14T7                                                              36  0.84
33301                                                                 36  0.84
181316                                                                36  0.84
118D8T7                                                               36  0.84
186O8T7                                                               36  0.84
218E22T7                                                              36  0.84
13936                                                                 36  0.84
163E9XP                                                               36  0.84
188I8XP                                                               36  0.84
163B9T7                                                               36  0.84
B75TP                                                                 36  0.84
219K22T7                                                              36  0.84
127E13XP                                                              36  0.84
229I5T7                                                               36  0.84
246C6T7                                                               36  0.84
133O8T7                                                               36  0.84
98C14T7                                                               36  0.84
122O1T7                                                               36  0.84
157F4T7                                                               36  0.84
178E19T7                                                              36  0.84
215G22T7                                                              36  0.84
157L22T7                                                              36  0.84
92F23T7                                                               36  0.84
183G24T7                                                              36  0.84
183A9XP                                                               36  0.84
161P6T7                                                               36  0.84
187F24XP                                                              36  0.84
G5B12T7                                                               36  0.84
114J24XP                                                              36  0.84
105B9T7                                                               36  0.84
14468                                                                 36  0.84
111J7T7                                                               36  0.84
131M21XP                                                              36  0.84
226M4T7                                                               36  0.84
40324                                                                 36  0.84
125N11T7                                                              36  0.84
93I10XP                                                               36  0.84
K3H10TP                                                               36  0.84
209D19T7                                                              36  0.84
82H7T7                                                                34  3.3
K2G10RP                                                               34  3.3
200I7T7                                                               34  3.3
H8H11RTM                                                              34  3.3
135H20XP                                                              34  3.3
173P23T7                                                              34  3.3
146P16T7                                                              34  3.3
171O13T7                                                              34  3.3
177J19T7                                                              34  3.3
120O7T7A                                                              34  3.3
291475                                                                34  3.3
170D13T7                                                              34  3.3
G11F5T7                                                               34  3.3
205H16T7                                                              34  3.3
173A24XP                                                              34  3.3
E2G10T7                                                               34  3.3
111A23T7                                                              34  3.3
123C7T7                                                               34  3.3
132J21XP                                                              34  3.3
G5F7T7                                                                34  3.3
151G18T7                                                              34  3.3
63B1T7                                                                34  3.3
121N4T7                                                               34  3.3
SBD1T7P                                                               34  3.3
246G8T7                                                               34  3.3
213K19T7                                                              34  3.3
223F20T7                                                              34  3.3
247H21T7                                                              34  3.3
14276                                                                 34  3.3
14342                                                                 34  3.3
46875                                                                 34  3.3
41A9T7                                                                34  3.3
78F10T7                                                               34  3.3
174N1T7                                                               34  3.3
188E15T7                                                              34  3.3
195J15T7                                                              34  3.3
F1E3T7                                                                34  3.3
106D22T7                                                              34  3.3
170I7T7                                                               34  3.3
174H24T7                                                              34  3.3
229M24T7                                                              34  3.3
78F10XP                                                               34  3.3
230H6YTM                                                              34  3.3
G11D11RTM                                                             34  3.3
33673                                                                 34  3.3
221O2T7                                                               34  3.3
G5A4T7                                                                34  3.3
285H9T7                                                               34  3.3
43645                                                                 34  3.3
117L10T7                                                              34  3.3
153G15T7                                                              34  3.3
123C1T7                                                               34  3.3
161M7T7                                                               34  3.3
G2D2T7                                                                34  3.3
480917                                                                34  3.3
144G16T7                                                              34  3.3
146P6T7                                                               34  3.3
119C9XP                                                               34  3.3
G12G9RTM                                                              34  3.3
116D4T7                                                               34  3.3
163C7T7                                                               34  3.3
192B23T7                                                              34  3.3
288F11T7                                                              34  3.3
211E7T7                                                               34  3.3
G1A5T7                                                                34  3.3
249H10T7                                                              34  3.3
220B14T7                                                              34  3.3
34G11T7                                                               34  3.3
32C6T7                                                                34  3.3
G12C4RTM                                                              34  3.3
33344                                                                 34  3.3
470679                                                                34  3.3
195E5T7                                                               34  3.3
G9H5T7                                                                34  3.3
122F16XP                                                              34  3.3
152J1T7                                                               34  3.3
154P15XP                                                              34  3.3
153G14T7                                                              34  3.3
124L6T7                                                               34  3.3
46709                                                                 34  3.3
204D17T7                                                              34  3.3
241I14T7                                                              34  3.3
H3C1RTM                                                               34  3.3
121G21T7                                                              34  3.3
226O24T7                                                              34  3.3
229N1T7                                                               34  3.3
96C14T7                                                               34  3.3
E10A10T7                                                              34  3.3
179K16T7                                                              34  3.3
221E5T7                                                               34  3.3
46871                                                                 34  3.3
202K1T7                                                               34  3.3
111M19T7                                                              34  3.3
107F5T7                                                               34  3.3
191G22T7                                                              34  3.3
132H11XP                                                              34  3.3
181154                                                                34  3.3
186E12T7                                                              34  3.3

>159O16T7
            Length = 463
            
 Score =  494 bits (249), Expect = e-138
 Identities = 276/282 (97%), Gaps = 3/282 (1%)
 Strand = Plus / Plus

                                                                        
Query: 3080 aggctgcttgtgaagaactgaggaacagtaggatgttcttaaagcttcttgaagcggttc 3139
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 75   aggctgcttgtnaagaactgaggaacagtaggatgttcttaaagcttcttgaagcggttc 134

                                                                        
Query: 3140 taaagacaggaaaccgtatgaacgttggaacaaaccgaggagatgcacatgcgttcaagc 3199
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 135  taaagacaggaaaccgtatgaacgttggaacaaaccgaggagatgcacatgcgttcaagc 194

                                                                        
Query: 3200 ttgatacacttctcaagctagtcgatgtcaaaggcgctgatgggaaaacaactctcttgc 3259
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 195  ttgatacacttctcaagctagtcgatgtcaaaggcgctgatgggaaaacaactctcttgc 254

                                                                        
Query: 3260 atttcgttgtacaagagataatccgagcagaaggcacacgtctct-caggtaacaataca 3318
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 255  atttcgttgtacaagagataatccgagcagaaggcacacgtctctccaggtaacaataca 314

                                                      
Query: 3319 caaacagatgacattaaatgcc-ggaaacta-ggtctccaag 3358
            ||| ||| |||||||||||||| |||||||| ||||||||||
Sbjct: 315  caancagntgacattaaatgccgggaaactagggtctccaag 356


 Score =  153 bits (77), Expect = 5e-36
 Identities = 77/77 (100%)
 Strand = Plus / Plus

                                                                        
Query: 2922 agttgatgcaatgctctatgtagccaactttgagtccgaggttgaatacttgaagaaatc 2981
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    agttgatgcaatgctctatgtagccaactttgagtccgaggttgaatacttgaagaaatc 60

                             
Query: 2982 ttttgagactcttgagg 2998
            |||||||||||||||||
Sbjct: 61   ttttgagactcttgagg 77


>20461
            Length = 288
            
 Score =  371 bits (187), Expect = e-101
 Identities = 187/187 (100%)
 Strand = Plus / Plus

                                                                        
Query: 2366 attagatgaggagatgattgagacgttgtttgtggcgaagtcgttaaacaacaaaccaaa 2425
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 102  attagatgaggagatgattgagacgttgtttgtggcgaagtcgttaaacaacaaaccaaa 161

                                                                        
Query: 2426 tcagagtcagacaactccaagatgtgttctcccgagcccgaaccaagagaacagagtcct 2485
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 162  tcagagtcagacaactccaagatgtgttctcccgagcccgaaccaagagaacagagtcct 221

                                                                        
Query: 2486 ggacccgaagaaggctcagaatattgccatcttgcttcgtgcacttaatgtcactataga 2545
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 222  ggacccgaagaaggctcagaatattgccatcttgcttcgtgcacttaatgtcactataga 281

                   
Query: 2546 agaagtt 2552
            |||||||
Sbjct: 282  agaagtt 288


 Score =  200 bits (101), Expect = 2e-50
 Identities = 101/101 (100%)
 Strand = Plus / Plus

                                                                        
Query: 2179 gaaactccgaaaccgaagctaaaggcgttacattgggataaagttagagcaagttcggat 2238
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    gaaactccgaaaccgaagctaaaggcgttacattgggataaagttagagcaagttcggat 60

                                                     
Query: 2239 cgtgagatggtttgggatcatcttcgatcaagctctttcaa 2279
            |||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   cgtgagatggtttgggatcatcttcgatcaagctctttcaa 101


>14451
            Length = 287
            
 Score =  299 bits (151), Expect = 4e-80
 Identities = 164/167 (98%), Gaps = 1/167 (0%)
 Strand = Plus / Plus

                                                                        
Query: 3824 gacgaagacaatcttcttcttcttcgtcgtcgtcttcaacctcttcgtctgatgaagacg 3883
            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 18   gacgaagacaatcttcttcttcttcgtcgtcgtcttcaaccacttcgtctgatgaagacg 77

                                                                        
Query: 3884 aacataactcaatctcattagtttcttaaggtgagatctcagctttgtctgtgcatgttg 3943
            ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 78   aacataactcaatctcattagtttcttaaggtgagatctcagc-ttgtctgtgcatcttg 136

                                                           
Query: 3944 ttgtaaaaagtatccagtattggattgttttgtcataatagatttaa 3990
            |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137  ttgtaaaaagtatccagtattggattgttttgtcataatagatttaa 183


 Score =  113 bits (57), Expect = 4e-24
 Identities = 76/85 (89%)
 Strand = Plus / Plus

                                                                        
Query: 4004 gagggagggaattaatgacagaaacaaagaagtgtttttcttttctgcatttgtgtnnnn 4063
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
Sbjct: 197  gagggagggaattaatgacagaaacaaagaagtgtttttcttttctgcatttgagtaaaa 256

                                     
Query: 4064 nnnntaatataggtttaccttaaaa 4088
                |||||||||||||||||||||
Sbjct: 257  aaaataatataggtttaccttaaaa 281


>33297
            Length = 404
            
 Score = 46.1 bits (23), Expect = 9e-04
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 3834 atcttcttcttcttcgtcgtcgtcttc 3860
            ||||||||||||||||||||| |||||
Sbjct: 145  atcttcttcttcttcgtcgtcatcttc 171


>157J7T7
            Length = 408
            
 Score = 46.1 bits (23), Expect = 9e-04
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 3834 atcttcttcttcttcgtcgtcgtcttc 3860
            ||||||||||||||||||||| |||||
Sbjct: 192  atcttcttcttcttcgtcgtcatcttc 166


>62466
           Length = 296
           
 Score = 44.1 bits (22), Expect = 0.003
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 409 ctcttcttcttattcttcttctactt 434
           ||||||||||| ||||||||||||||
Sbjct: 87  ctcttcttcttcttcttcttctactt 112


>227G24T7
            Length = 509
            
 Score = 44.1 bits (22), Expect = 0.003
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 3835 tcttcttcttcttcgtcgtcgtcttc 3860
            ||||||||||||||||| ||||||||
Sbjct: 62   tcttcttcttcttcgtcttcgtcttc 87


>470746
            Length = 306
            
 Score = 44.1 bits (22), Expect = 0.003
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 3838 tcttcttcttcgtcgtcgtcttcaacctct 3867
            ||||||||||| ||||| ||||||||||||
Sbjct: 302  tcttcttcttcttcgtcttcttcaacctct 273


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3835 tcttcttcttcttcgtc 3851
            |||||||||||||||||
Sbjct: 302  tcttcttcttcttcgtc 286


>36F9T7
            Length = 400
            
 Score = 42.1 bits (21), Expect = 0.014
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 3832 caatcttcttcttcttcgtcgtcgtcttc 3860
            ||||||||||||||||| || ||||||||
Sbjct: 148  caatcttcttcttcttcttcttcgtcttc 176


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 23/25 (92%)
 Strand = Plus / Plus

                                     
Query: 3835 tcttcttcttcttcgtcgtcgtctt 3859
            |||||||||||||| ||||| ||||
Sbjct: 154  tcttcttcttcttcttcgtcttctt 178


>183P16T7
            Length = 485
            
 Score = 42.1 bits (21), Expect = 0.014
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 3832 caatcttcttcttcttcgtcgtcgtcttc 3860
            ||||||||||||||||| || ||||||||
Sbjct: 26   caatcttcttcttcttcttcttcgtcttc 54


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 23/25 (92%)
 Strand = Plus / Plus

                                     
Query: 3835 tcttcttcttcttcgtcgtcgtctt 3859
            |||||||||||||| ||||| ||||
Sbjct: 32   tcttcttcttcttcttcgtcttctt 56


>187H11T7
            Length = 562
            
 Score = 42.1 bits (21), Expect = 0.014
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 3832 caatcttcttcttcttcgtcgtcgtcttc 3860
            ||||||||||||||||| || ||||||||
Sbjct: 47   caatcttcttcttcttcttcttcgtcttc 75


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 23/25 (92%)
 Strand = Plus / Plus

                                     
Query: 3835 tcttcttcttcttcgtcgtcgtctt 3859
            |||||||||||||| ||||| ||||
Sbjct: 53   tcttcttcttcttcttcgtcttctt 77


>174D23T7
            Length = 231
            
 Score = 40.1 bits (20), Expect = 0.054
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1138 ggagaagaagatgaagaaga 1157
            ||||||||||||||||||||
Sbjct: 9    ggagaagaagatgaagaaga 28


>110K9T7
            Length = 419
            
 Score = 40.1 bits (20), Expect = 0.054
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1138 ggagaagaagatgaagaaga 1157
            ||||||||||||||||||||
Sbjct: 124  ggagaagaagatgaagaaga 143


>G11E5T7
            Length = 525
            
 Score = 40.1 bits (20), Expect = 0.054
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1138 ggagaagaagatgaagaaga 1157
            ||||||||||||||||||||
Sbjct: 60   ggagaagaagatgaagaaga 79


>190309
           Length = 300
           
 Score = 40.1 bits (20), Expect = 0.054
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 411 cttcttcttattcttcttctactt 434
           ||||||||| ||||||||||||||
Sbjct: 199 cttcttcttcttcttcttctactt 176


>219K19T7
           Length = 558
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 409 ctcttcttcttattcttcttcta 431
           ||||||||||| |||||||||||
Sbjct: 62  ctcttcttcttcttcttcttcta 40


>89F7XP
            Length = 358
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1140 agaagaagatgaagaagatgagt 1162
            ||||||||| |||||||||||||
Sbjct: 316  agaagaagacgaagaagatgagt 338


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 23/25 (92%)
 Strand = Plus / Minus

                                    
Query: 410 tcttcttcttattcttcttctactt 434
           ||||| |||| ||||||||||||||
Sbjct: 330 tcttcgtcttcttcttcttctactt 306


>64B2T7
            Length = 483
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
            |||||||||| ||||||||||||
Sbjct: 104  aatcttcttcatcttcgtcgtcg 82


>137I6T7
            Length = 235
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1135 atcggagaagaagatgaagaag 1156
            |||||||||||||||| |||||
Sbjct: 57   atcggagaagaagatgnagaag 36


>48A5T7
            Length = 373
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1140 agaagaagatgaagaagatgagt 1162
            |||||||||||||||||| ||||
Sbjct: 210  agaagaagatgaagaagaagagt 232


>181304
           Length = 492
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 412 ttcttcttattcttcttct 430
           |||||||||||||||||||
Sbjct: 309 ttcttcttattcttcttct 291


>303F8T7
           Length = 444
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 409 ctcttcttcttattcttcttctactta 435
           ||||||||||| |||||||||| ||||
Sbjct: 248 ctcttcttcttcttcttcttcttctta 274


>203B19T7
            Length = 524
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1790 cgtcgtcgtcttcttcttc 1808
            |||||||||||||||||||
Sbjct: 37   cgtcgtcgtcttcttcttc 19


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 10   gaagaagatgaagaaga 26


>SCF9T7P
            Length = 420
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1140 agaagaagatgaagaagatgagt 1162
            |||||||||||||||||| ||||
Sbjct: 199  agaagaagatgaagaagaagagt 221


>G11A5T7
            Length = 588
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1138 ggagaagaagatgaagaagatga 1160
            ||||||||||| |||||||||||
Sbjct: 402  ggagaagaagaagaagaagatga 424


>171I13T7
           Length = 466
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 409 ctcttcttcttattcttcttcta 431
           ||||||||||| |||||||||||
Sbjct: 57  ctcttcttcttcttcttcttcta 35


>198N4T7
            Length = 504
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1140 agaagaagatgaagaagatgagt 1162
            |||||||||||||||||| ||||
Sbjct: 72   agaagaagatgaagaagaagagt 94


>221D4T7
           Length = 463
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 409 ctcttcttcttattcttcttctactta 435
           ||||||||||| |||||||||| ||||
Sbjct: 248 ctcttcttcttcttcttcttcttctta 274


>33709
           Length = 333
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 410 tcttcttcttattcttcttctac 432
           |||||||||| ||||||||||||
Sbjct: 170 tcttcttcttcttcttcttctac 192


>133I5T7
           Length = 581
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           |||||||||||||||| |||||
Sbjct: 203 ctcttcttcttattctncttct 224


>110G16XP
           Length = 280
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 409 ctcttcttcttattcttcttcta 431
           ||||||||||| |||||||||||
Sbjct: 178 ctcttcttcttcttcttcttcta 156


>158B2T7
            Length = 454
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1140 agaagaagatgaagaagatgagt 1162
            |||||||||||||||||| ||||
Sbjct: 201  agaagaagatgaagaagaagagt 223


>178O7T7
            Length = 539
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
            |||||||||| ||||||||||||
Sbjct: 107  aatcttcttcatcttcgtcgtcg 85


>108A19T7
            Length = 529
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1140 agaagaagatgaagaagatgagt 1162
            |||||||||||||||||| ||||
Sbjct: 183  agaagaagatgaagaagaagagt 205


>141M13T7
            Length = 498
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1140 agaagaagatgaagaagatgagt 1162
            ||||||||| |||||||||||||
Sbjct: 165  agaagaagacgaagaagatgagt 187


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 23/25 (92%)
 Strand = Plus / Minus

                                    
Query: 410 tcttcttcttattcttcttctactt 434
           ||||| |||| ||||||||||||||
Sbjct: 179 tcttcgtcttcttcttcttctactt 155


>F2H7T7
           Length = 374
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 409 ctcttcttcttattcttcttcta 431
           ||||||||||| |||||||||||
Sbjct: 214 ctcttcttcttcttcttcttcta 236


>203B5T7
            Length = 461
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1140 agaagaagatgaagaagat 1158
            |||||||||||||||||||
Sbjct: 19   agaagaagatgaagaagat 1


>151N1XP
           Length = 564
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 412 ttcttcttattcttcttct 430
           |||||||||||||||||||
Sbjct: 337 ttcttcttattcttcttct 319


>208I9T7
            Length = 282
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1135 atcggagaagaagatgaagaag 1156
            |||||||||||||||| |||||
Sbjct: 57   atcggagaagaagatgnagaag 36


>139M21T7
            Length = 440
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1790 cgtcgtcgtcttcttcttc 1808
            |||||||||||||||||||
Sbjct: 145  cgtcgtcgtcttcttcttc 127


>219K18T7
           Length = 573
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 409 ctcttcttcttattcttcttcta 431
           ||||||||||| |||||||||||
Sbjct: 66  ctcttcttcttcttcttcttcta 44


>14551
           Length = 180
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 412 ttcttcttattcttcttct 430
           |||||||||||||||||||
Sbjct: 163 ttcttcttattcttcttct 145


>88G21T7
            Length = 403
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1790 cgtcgtcgtcttcttcttc 1808
            |||||||||||||||||||
Sbjct: 367  cgtcgtcgtcttcttcttc 385


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 394  gaagaagatgaagaaga 378


>H8C11T7
           Length = 620
           
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 408 gctcttcttcttattcttcttct 430
           |||||||||||| ||||||||||
Sbjct: 257 gctcttcttcttcttcttcttct 279


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3835 tcttcttcttcttcgtc 3851
            |||||||||||||||||
Sbjct: 271  tcttcttcttcttcgtc 287


>205E15T7
            Length = 485
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
            |||||||||| ||||||||||||
Sbjct: 138  aatcttcttcatcttcgtcgtcg 116


>178N7T7
            Length = 490
            
 Score = 38.2 bits (19), Expect = 0.21
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 3833 aatcttcttcttcttcgtcgtcg 3855
            |||||||||| ||||||||||||
Sbjct: 107  aatcttcttcatcttcgtcgtcg 85


>170P8T7
            Length = 452
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 3835 tcttcttcttcttcgtcgtcgt 3856
            ||||||||||||||||| ||||
Sbjct: 237  tcttcttcttcttcgtcctcgt 216


>116L2XP
           Length = 459
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 368 ctcttcttctttttcttcttct 347


>G12C5RTM
            Length = 399
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1140 agaagaagatgaagaaga 1157
            ||||||||||||||||||
Sbjct: 241  agaagaagatgaagaaga 224


>215K8T7
            Length = 476
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1140 agaagaagatgaagaaga 1157
            ||||||||||||||||||
Sbjct: 140  agaagaagatgaagaaga 157


>52652
            Length = 306
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1140 agaagaagatgaagaaga 1157
            ||||||||||||||||||
Sbjct: 189  agaagaagatgaagaaga 206


>185D14T7
           Length = 603
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 381 gaagaagaaagaagaaga 398
           ||||||||||||||||||
Sbjct: 44  gaagaagaaagaagaaga 27


>33301
            Length = 398
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 1981 cctccgcctcctcctcctcccccacc 2006
            ||||| |||||||||||||| |||||
Sbjct: 227  cctccacctcctcctcctcctccacc 252


>181316
            Length = 365
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 1798 tcttcttcttctgtttgttctt 1819
            ||||||||||||||| ||||||
Sbjct: 39   tcttcttcttctgttagttctt 60


>118D8T7
           Length = 412
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 410 tcttcttcttattcttcttcta 431
           |||||||||| |||||||||||
Sbjct: 45  tcttcttcttcttcttcttcta 24


>186O8T7
           Length = 552
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 410 tcttcttcttattcttcttcta 431
           |||||||||| |||||||||||
Sbjct: 120 tcttcttcttcttcttcttcta 99


>218E22T7
           Length = 380
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 3   ctcttcttcttcttcttcttct 24


>13936
            Length = 286
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 1798 tcttcttcttctgtttgttctt 1819
            ||||||||||||||| ||||||
Sbjct: 89   tcttcttcttctgttagttctt 110


>163E9XP
           Length = 438
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 259 ctcttcttctttttcttcttct 238


>188I8XP
           Length = 617
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 410 tcttcttcttattcttcttcta 431
           |||||||||| |||||||||||
Sbjct: 354 tcttcttcttcttcttcttcta 333


 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 364 ctcttcttcttcttcttcttct 343


>163B9T7
            Length = 285
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 1141 gaagaagatgaagaagatgagt 1162
            ||||||||||||||||| ||||
Sbjct: 152  gaagaagatgaagaagaagagt 173


>B75TP
           Length = 370
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 30  ctcttcttcttcttcttcttct 51


>219K22T7
           Length = 541
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 47  ctcttcttcttcttcttcttct 26


>127E13XP
           Length = 257
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 134 ctcttcttcttcttcttcttct 155


>229I5T7
           Length = 551
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 50  ctcttcttcttcttcttcttct 29


>246C6T7
            Length = 376
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1140 agaagaagatgaagaaga 1157
            ||||||||||||||||||
Sbjct: 90   agaagaagatgaagaaga 107


>133O8T7
           Length = 549
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 381 gaagaagaaagaagaaga 398
           ||||||||||||||||||
Sbjct: 46  gaagaagaaagaagaaga 29


>98C14T7
           Length = 552
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 40  ctcttcttcttcttcttcttct 61


>122O1T7
            Length = 386
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 3838 tcttcttcttcgtcgtcgtctt 3859
            ||||||||||||||||| ||||
Sbjct: 188  tcttcttcttcgtcgtcctctt 167


>157F4T7
            Length = 367
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1792 tcgtcgtcttcttcttct 1809
            ||||||||||||||||||
Sbjct: 84   tcgtcgtcttcttcttct 101


>178E19T7
           Length = 230
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 410 tcttcttcttattcttcttct 430
           |||||||||| ||||||||||
Sbjct: 23  tcttcttcttnttcttcttct 43


>215G22T7
            Length = 264
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 3838 tcttcttcttcgtcgtcgtctt 3859
            ||||||||||||||||| ||||
Sbjct: 229  tcttcttcttcgtcgtcctctt 208


>157L22T7
            Length = 460
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1140 agaagaagatgaagaaga 1157
            ||||||||||||||||||
Sbjct: 140  agaagaagatgaagaaga 157


>92F23T7
           Length = 108
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 410 tcttcttcttattcttcttcta 431
           |||||||||| |||||||||||
Sbjct: 89  tcttcttcttcttcttcttcta 68


>183G24T7
            Length = 368
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1792 tcgtcgtcttcttcttct 1809
            ||||||||||||||||||
Sbjct: 30   tcgtcgtcttcttcttct 13


>183A9XP
           Length = 561
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 410 tcttcttcttattcttcttcta 431
           |||||||||| |||||||||||
Sbjct: 396 tcttcttcttcttcttcttcta 417


>161P6T7
            Length = 444
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1981 cctccgcctcctcctcct 1998
            ||||||||||||||||||
Sbjct: 191  cctccgcctcctcctcct 174


>187F24XP
            Length = 578
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1979 tgcctccgcctcctcctcctcc 2000
            |||| |||||||||||||||||
Sbjct: 208  tgccgccgcctcctcctcctcc 187


>G5B12T7
            Length = 505
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                      
Query: 1798 tcttcttcttctgtttgttcttcacc 1823
            |||||||||||| ||| |||||||||
Sbjct: 243  tcttcttcttcttttttttcttcacc 218


>114J24XP
           Length = 424
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 169 ctcttcttcttcttcttcttct 190


>105B9T7
            Length = 369
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1140 agaagaagatgaagaaga 1157
            ||||||||||||||||||
Sbjct: 180  agaagaagatgaagaaga 197


>14468
           Length = 250
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 410 tcttcttcttattcttcttcta 431
           |||||||||| |||||||||||
Sbjct: 55  tcttcttcttcttcttcttcta 34


>111J7T7
            Length = 473
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1140 agaagaagatgaagaaga 1157
            ||||||||||||||||||
Sbjct: 187  agaagaagatgaagaaga 204


>131M21XP
           Length = 411
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 195 ctcttcttcttcttcttcttct 174


>226M4T7
            Length = 530
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1984 ccgcctcctcctcctccc 2001
            ||||||||||||||||||
Sbjct: 13   ccgcctcctcctcctccc 30


>40324
           Length = 344
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 410 tcttcttcttattcttct 427
           ||||||||||||||||||
Sbjct: 91  tcttcttcttattcttct 108


>125N11T7
            Length = 389
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 3831 acaatcttcttcttcttc 3848
            ||||||||||||||||||
Sbjct: 88   acaatcttcttcttcttc 105


>93I10XP
            Length = 563
            
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1987 cctcctcctcctcccccaccgt 2008
            |||||||||||| |||||||||
Sbjct: 94   cctcctcctccttccccaccgt 73


>K3H10TP
           Length = 257
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 410 tcttcttcttattcttcttcta 431
           |||||||||| |||||||||||
Sbjct: 46  tcttcttcttcttcttcttcta 25


>209D19T7
           Length = 537
           
 Score = 36.2 bits (18), Expect = 0.84
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 409 ctcttcttcttattcttcttct 430
           ||||||||||| ||||||||||
Sbjct: 49  ctcttcttcttcttcttcttct 28


>82H7T7
            Length = 584
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 1134 aatcggagaagaagatg 1150
            |||||||||||||||||
Sbjct: 16   aatcggagaagaagatg 32


>K2G10RP
            Length = 572
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1476 ctttagatctccgacggttac 1496
            ||||||||| |||||||||||
Sbjct: 387  ctttagatcaccgacggttac 367


>200I7T7
            Length = 383
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3838 tcttcttcttcgtcgtcgtct 3858
            |||||||| ||||||||||||
Sbjct: 55   tcttcttcgtcgtcgtcgtct 75


>H8H11RTM
            Length = 379
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||| |||||||||||
Sbjct: 272  agaagaagaagaagaagatga 292


>135H20XP
           Length = 325
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 351 ctcttctcttttctcag 367
           |||||||||||||||||
Sbjct: 71  ctcttctcttttctcag 55


>173P23T7
            Length = 527
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 73   gaagaagatgaagaaga 57


>146P16T7
           Length = 443
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 380 tgaagaagaaagaagaa 396
           |||||||||||||||||
Sbjct: 251 tgaagaagaaagaagaa 235


>171O13T7
           Length = 433
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 372 tgaactcttgaagaaga 388
           |||||||||||||||||
Sbjct: 263 tgaactcttgaagaaga 279


>177J19T7
           Length = 433
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 411 cttcttcttattcttcttcta 431
           ||||||||| |||||||||||
Sbjct: 25  cttcttcttcttcttcttcta 5


>120O7T7A
            Length = 359
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||| |||||||||||
Sbjct: 49   agaagaagaagaagaagatga 29


>291475
            Length = 371
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3804 acctcttcctggactcg 3820
            |||||||||||||||||
Sbjct: 3    acctcttcctggactcg 19


>170D13T7
            Length = 431
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1987 cctcctcctcctcccccaccg 2007
            |||||||||||||| ||||||
Sbjct: 311  cctcctcctcctccgccaccg 291


>G11F5T7
           Length = 529
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 348 tctctcttctcttttct 364
           |||||||||||||||||
Sbjct: 118 tctctcttctcttttct 102


>205H16T7
            Length = 425
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1141 gaagaagatgaagaagatgag 1161
            |||||||| ||||||||||||
Sbjct: 41   gaagaagaagaagaagatgag 21


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3834 atcttcttcttcttcgtcgtc 3854
            ||||||||||||||| |||||
Sbjct: 24   atcttcttcttcttcttcgtc 44


>173A24XP
            Length = 425
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 1463 gattgaatcaaatcttt 1479
            |||||||||||||||||
Sbjct: 328  gattgaatcaaatcttt 344


>E2G10T7
           Length = 600
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 410 tcttcttcttattcttcttct 430
           |||||||||| ||||||||||
Sbjct: 344 tcttcttcttcttcttcttct 324


>111A23T7
            Length = 476
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1140 agaagaagatgaagaag 1156
            |||||||||||||||||
Sbjct: 24   agaagaagatgaagaag 8


>123C7T7
           Length = 381
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 411 cttcttcttattcttcttcta 431
           ||||||||| |||||||||||
Sbjct: 33  cttcttcttcttcttcttcta 13


>132J21XP
           Length = 553
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 266 ttaagagaacaaaccaaaaac 286
           ||||||||||||| |||||||
Sbjct: 489 ttaagagaacaaaacaaaaac 469


>G5F7T7
            Length = 531
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 2772 gactgaacttcttgaga 2788
            |||||||||||||||||
Sbjct: 270  gactgaacttcttgaga 254


>151G18T7
            Length = 476
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2331 aatgtggttgttgagat 2347
            |||||||||||||||||
Sbjct: 238  aatgtggttgttgagat 254


>63B1T7
            Length = 468
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3015 ttctctctctttttacc 3031
            |||||||||||||||||
Sbjct: 59   ttctctctctttttacc 75


>121N4T7
            Length = 491
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 20   gaagaagatgaagaaga 4


>SBD1T7P
            Length = 491
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 1141 gaagaagatgaagaagatgag 1161
            |||||||||||||| ||||||
Sbjct: 286  gaagaagatgaagatgatgag 306


>246G8T7
            Length = 268
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1829 aagcttctcataagtca 1845
            |||||||||||||||||
Sbjct: 122  aagcttctcataagtca 106


>213K19T7
           Length = 552
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 954 ctccaccaataacaaca 970
           |||||||||||||||||
Sbjct: 324 ctccaccaataacaaca 308


>223F20T7
           Length = 552
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 954 ctccaccaataacaaca 970
           |||||||||||||||||
Sbjct: 81  ctccaccaataacaaca 97


>247H21T7
           Length = 472
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 409 ctcttcttcttattcttcttc 429
           ||||||||||| |||||||||
Sbjct: 21  ctcttcttcttcttcttcttc 1


>14276
            Length = 778
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1141 gaagaagatgaagaagatgag 1161
            |||||||| ||||||||||||
Sbjct: 41   gaagaagaagaagaagatgag 21


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3834 atcttcttcttcttcgtcgtc 3854
            ||||||||||||||| |||||
Sbjct: 24   atcttcttcttcttcttcgtc 44


>14342
           Length = 250
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 954 ctccaccaataacaaca 970
           |||||||||||||||||
Sbjct: 128 ctccaccaataacaaca 112


>46875
           Length = 291
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 411 cttcttcttattcttct 427
           |||||||||||||||||
Sbjct: 108 cttcttcttattcttct 92


>41A9T7
           Length = 243
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 381 gaagaagaaagaagaagataa 401
           ||||||| |||||||||||||
Sbjct: 34  gaagaaggaagaagaagataa 54


>78F10T7
            Length = 412
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 323  gaagaagatgaagaaga 307


>174N1T7
           Length = 473
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 954 ctccaccaataacaaca 970
           |||||||||||||||||
Sbjct: 308 ctccaccaataacaaca 292


>188E15T7
           Length = 237
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 409 ctcttcttcttattcttcttc 429
           ||||||||||| |||||||||
Sbjct: 86  ctcttcttcttcttcttcttc 66


>195J15T7
            Length = 412
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1987 cctcctcctcctccccc 2003
            |||||||||||||||||
Sbjct: 146  cctcctcctcctccccc 130


>F1E3T7
           Length = 530
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 954 ctccaccaataacaaca 970
           |||||||||||||||||
Sbjct: 108 ctccaccaataacaaca 92


>106D22T7
           Length = 498
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 411 cttcttcttattcttcttcta 431
           ||||||||| |||||||||||
Sbjct: 29  cttcttcttcttcttcttcta 9


>170I7T7
           Length = 538
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 409 ctcttcttcttattcttcttc 429
           ||||||||||| |||||||||
Sbjct: 3   ctcttcttcttcttcttcttc 23


>174H24T7
            Length = 510
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||| |||||||||||
Sbjct: 113  agaagaagaagaagaagatga 93


>229M24T7
            Length = 534
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1141 gaagaagatgaagaagatgag 1161
            |||||||| ||||||||||||
Sbjct: 33   gaagaagaagaagaagatgag 13


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3834 atcttcttcttcttcgtcgtc 3854
            ||||||||||||||| |||||
Sbjct: 16   atcttcttcttcttcttcgtc 36


>78F10XP
            Length = 510
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 210  gaagaagatgaagaaga 194


>230H6YTM
           Length = 397
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 1   tttaataaaataaaaat 17
           |||||||||||||||||
Sbjct: 258 tttaataaaataaaaat 242


>G11D11RTM
            Length = 389
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3835 tcttcttcttcttcgtc 3851
            |||||||||||||||||
Sbjct: 265  tcttcttcttcttcgtc 249


>33673
            Length = 331
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||||| |||||||||
Sbjct: 111  agaagaagatggagaagatga 91


>221O2T7
           Length = 384
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 411 cttcttcttattcttcttcta 431
           ||||||||| |||||||||||
Sbjct: 26  cttcttcttcttcttcttcta 6


>G5A4T7
            Length = 446
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3833 aatcttcttcttcttcg 3849
            |||||||||||||||||
Sbjct: 222  aatcttcttcttcttcg 206


>285H9T7
            Length = 559
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1829 aagcttctcataagtca 1845
            |||||||||||||||||
Sbjct: 370  aagcttctcataagtca 354


>43645
            Length = 337
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2331 aatgtggttgttgagat 2347
            |||||||||||||||||
Sbjct: 32   aatgtggttgttgagat 48


>117L10T7
            Length = 502
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1829 aagcttctcataagtca 1845
            |||||||||||||||||
Sbjct: 233  aagcttctcataagtca 217


>153G15T7
            Length = 352
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3836 cttcttcttcttcgtcg 3852
            |||||||||||||||||
Sbjct: 93   cttcttcttcttcgtcg 109


>123C1T7
            Length = 423
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1980 gcctccgcctcctcctcctcc 2000
            |||||| ||||||||||||||
Sbjct: 259  gcctcctcctcctcctcctcc 239


>161M7T7
            Length = 437
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1140 agaagaagatgaagaag 1156
            |||||||||||||||||
Sbjct: 27   agaagaagatgaagaag 11


>G2D2T7
            Length = 466
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3833 aatcttcttcttcttcg 3849
            |||||||||||||||||
Sbjct: 222  aatcttcttcttcttcg 206


>480917
           Length = 214
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 266 ttaagagaacaaaccaaaaac 286
           ||||||||||||| |||||||
Sbjct: 75  ttaagagaacaaaacaaaaac 95


>144G16T7
            Length = 375
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1137 cggagaagaagatgaagaaga 1157
            |||||||||||| ||||||||
Sbjct: 244  cggagaagaagaagaagaaga 224


>146P6T7
            Length = 464
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 4210 gatcattataaatcact 4226
            |||||||||||||||||
Sbjct: 170  gatcattataaatcact 154


>119C9XP
           Length = 568
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 266 ttaagagaacaaaccaaaaac 286
           ||||||||||||| |||||||
Sbjct: 551 ttaagagaacaaaacaaaaac 531


>G12G9RTM
           Length = 396
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 416 tcttattcttcttctacttac 436
           |||| ||||||||||||||||
Sbjct: 229 tcttcttcttcttctacttac 209


>116D4T7
            Length = 428
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3835 tcttcttcttcttcgtc 3851
            |||||||||||||||||
Sbjct: 231  tcttcttcttcttcgtc 247


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 409 ctcttcttcttattcttcttc 429
           ||||||||||| |||||||||
Sbjct: 224 ctcttcttcttcttcttcttc 244


>163C7T7
            Length = 524
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||| |||||||||||
Sbjct: 32   agaagaagaagaagaagatga 12


>192B23T7
           Length = 430
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 409 ctcttcttcttattcttcttc 429
           ||||||||||| |||||||||
Sbjct: 7   ctcttcttcttcttcttcttc 27


>288F11T7
            Length = 603
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 63   gaagaagatgaagaaga 47


>211E7T7
            Length = 465
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 321  gaagaagatgaagaaga 305


>G1A5T7
           Length = 475
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 379 ttgaagaagaaagaagaagat 399
           |||||||||||||| ||||||
Sbjct: 28  ttgaagaagaaagacgaagat 8


>249H10T7
            Length = 328
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3835 tcttcttcttcttcgtc 3851
            |||||||||||||||||
Sbjct: 25   tcttcttcttcttcgtc 9


>220B14T7
            Length = 535
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||| |||||||||||
Sbjct: 36   agaagaagaagaagaagatga 56


>34G11T7
           Length = 400
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 382 aagaagaaagaagaaga 398
           |||||||||||||||||
Sbjct: 44  aagaagaaagaagaaga 60


>32C6T7
           Length = 400
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 409 ctcttcttcttattcttcttc 429
           ||||||||||| |||||||||
Sbjct: 40  ctcttcttcttcttcttcttc 60


>G12C4RTM
           Length = 373
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 381 gaagaagaaagaagaagataa 401
           ||||||||| |||||||||||
Sbjct: 220 gaagaagaaggaagaagataa 240


>33344
            Length = 333
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 1794 gtcgtcttcttcttctg 1810
            |||||||||||||||||
Sbjct: 307  gtcgtcttcttcttctg 323


>470679
            Length = 310
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3832 caatcttcttcttcttc 3848
            |||||||||||||||||
Sbjct: 263  caatcttcttcttcttc 279


>195E5T7
            Length = 618
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1829 aagcttctcataagtca 1845
            |||||||||||||||||
Sbjct: 212  aagcttctcataagtca 196


>G9H5T7
           Length = 436
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 416 tcttattcttcttctacttac 436
           |||| ||||||||||||||||
Sbjct: 172 tcttcttcttcttctacttac 192


>122F16XP
           Length = 404
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 1   tttaataaaataaaaat 17
           |||||||||||||||||
Sbjct: 388 tttaataaaataaaaat 372


>152J1T7
           Length = 486
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 381 gaagaagaaagaagaagataa 401
           ||||||||| |||||||||||
Sbjct: 279 gaagaagaaggaagaagataa 299


>154P15XP
           Length = 485
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 347 ttctctcttctcttttc 363
           |||||||||||||||||
Sbjct: 292 ttctctcttctcttttc 276


>153G14T7
            Length = 454
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3836 cttcttcttcttcgtcg 3852
            |||||||||||||||||
Sbjct: 93   cttcttcttcttcgtcg 109


>124L6T7
           Length = 536
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 954 ctccaccaataacaaca 970
           |||||||||||||||||
Sbjct: 71  ctccaccaataacaaca 87


>46709
            Length = 405
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3833 aatcttcttcttcttcg 3849
            |||||||||||||||||
Sbjct: 253  aatcttcttcttcttcg 237


>204D17T7
            Length = 491
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||||||||| |||||
Sbjct: 153  agaagaagatgaagatgatga 173


>241I14T7
            Length = 553
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2331 aatgtggttgttgagat 2347
            |||||||||||||||||
Sbjct: 217  aatgtggttgttgagat 233


>H3C1RTM
            Length = 353
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3842 cttcttcgtcgtcgtct 3858
            |||||||||||||||||
Sbjct: 273  cttcttcgtcgtcgtct 289


>121G21T7
            Length = 372
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1144 gaagatgaagaagatga 1160
            |||||||||||||||||
Sbjct: 120  gaagatgaagaagatga 104


>226O24T7
            Length = 451
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1137 cggagaagaagatgaagaaga 1157
            |||||||||||| ||||||||
Sbjct: 250  cggagaagaagaagaagaaga 230


>229N1T7
            Length = 362
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1141 gaagaagatgaagaagatgag 1161
            |||||||| ||||||||||||
Sbjct: 33   gaagaagaagaagaagatgag 13


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3834 atcttcttcttcttcgtcgtc 3854
            ||||||||||||||| |||||
Sbjct: 16   atcttcttcttcttcttcgtc 36


>96C14T7
            Length = 480
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 3835 tcttcttcttcttcgtc 3851
            |||||||||||||||||
Sbjct: 26   tcttcttcttcttcgtc 10


>E10A10T7
           Length = 608
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 372 tgaactcttgaagaaga 388
           |||||||||||||||||
Sbjct: 100 tgaactcttgaagaaga 116


>179K16T7
            Length = 441
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3804 acctcttcctggactcg 3820
            |||||||||||||||||
Sbjct: 265  acctcttcctggactcg 281


>221E5T7
            Length = 516
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 3835 tcttcttcttcttcgtc 3851
            |||||||||||||||||
Sbjct: 188  tcttcttcttcttcgtc 204


>46871
            Length = 325
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||| |||||||||||
Sbjct: 190  agaagaagaagaagaagatga 170


>202K1T7
            Length = 480
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1140 agaagaagatgaagaagatga 1160
            ||||||||| |||||||||||
Sbjct: 49   agaagaagaagaagaagatga 29


>111M19T7
            Length = 491
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 2331 aatgtggttgttgagat 2347
            |||||||||||||||||
Sbjct: 199  aatgtggttgttgagat 215


>107F5T7
            Length = 534
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 76   gaagaagatgaagaaga 60


>191G22T7
            Length = 536
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1141 gaagaagatgaagaaga 1157
            |||||||||||||||||
Sbjct: 83   gaagaagatgaagaaga 67


>132H11XP
           Length = 393
           
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 381 gaagaagaaagaagaagataa 401
           ||||||||| |||||||||||
Sbjct: 203 gaagaagaaggaagaagataa 223


>181154
            Length = 417
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                             
Query: 1800 ttcttcttctgtttgtt 1816
            |||||||||||||||||
Sbjct: 126  ttcttcttctgtttgtt 110


>186E12T7
            Length = 490
            
 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                 
Query: 1141 gaagaagatgaagaagatgag 1161
            |||||||| ||||||||||||
Sbjct: 53   gaagaagaagaagaagatgag 33


 Score = 34.2 bits (17), Expect = 3.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 3834 atcttcttcttcttcgtcgtc 3854
            ||||||||||||||| |||||
Sbjct: 36   atcttcttcttcttcttcgtc 56


  Database: Ath_t2_s3+s5.2
    Posted date:  Nov 12, 1999  9:46 AM
  Number of letters in database: 15,805,129
  Number of sequences in database:  40,423
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 71844
Number of Sequences: 40423
Number of extensions: 71844
Number of successful extensions: 8060
Number of sequences better than 10.0: 249
length of query: 4350
length of database: 15,805,129
effective HSP length: 18
effective length of query: 4332
effective length of database: 15077515
effective search space: 65315794980
effective search space used: 65315794980
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)