NetGene2 World Wide Web Server

Center for Biological Sequence Analysis

The Technical University of Denmark

DK-2800 Lyngby, Denmark

Performing prediction for locus (size: 5040) Species: A. thaliana

Starting prediction in + strand

Starting prediction in - strand

Preparing output

Prediction done

********************** NetGene2 v. 2.4 ************************ The sequence: locus has the following composition: Length: 5040 nucleotides. 32.3% A, 18.2% C, 18.3% G, 31.2% T, 0.0% X, 36.5% G+C Donor splice sites, direct strand --------------------------------- pos 5'->3' phase strand confidence 5' exon intron 3' 265 2 + 0.74 ACCCATTTAC^GTACTTGACC 2618 2 + 1.00 GATCATTCAG^GTATATATTT H 3977 2 + 0.74 ATTCTGATAT^GTGAGAGTCA 4000 1 + 0.74 TTTGTTATAT^GTAAATACTA Donor splice sites, complement strand ------------------------------------- pos 3'->5' pos 5'->3' phase strand confidence 5' exon intron 3' 3474 1567 0 - 0.95 CCAACAACTG^GTAAACCAAG 3458 1583 2 - 0.74 CAAGCTTCAA^GTACTCTTTC 3121 1920 2 - 0.74 TAAATCCAAC^GTTTGTAAAC 1881 3160 1 - 0.81 CCAGCTACAA^GTAAAGTACT 1689 3352 0 - 0.87 GATTGGAATG^GTAAAACGAC 1667 3374 1 - 0.74 TGAAGAAGAA^GTAAATTAGG 246 4795 0 - 0.81 GTTTCCAGAG^GTGATGGTAT 229 4812 0 - 0.92 TATTTACTTG^GTGAGAAATG Acceptor splice sites, direct strand ------------------------------------ pos 5'->3' phase strand confidence 5' intron exon 3' 2695 2 + 0.96 TTCTTCTCAG^TTTCGATGGC 3170 0 + 0.83 GTTTGTGAAG^CTTTTGGAGG 3425 0 + 0.56 TAGTCTTCAG^GTTATGTCGA 4939 1 + 0.67 CAATGCTCAG^ACCCAACCGG Acceptor splice sites, complement strand ---------------------------------------- pos 3'->5' pos 5'->3' phase strand confidence 5' intron exon 3' 3970 1071 1 - 0.97 CACATATCAG^AATCCGACCC H 824 4217 0 - 0.94 GTAATTTCAG^TCGGTCAAAG Branch points, direct strand ---------------------------- acceptor branch pos 5'->3' pos 5'->3' strand score 5' A 3' 2695 2662 + -1.90 CAATCAATTGAAAAAACCCT 3170 3146 + -3.45 TAAAGAGCTGAGATCTCGTG 3425 3411 + -1.85 AATGGTGGTAATAGTAGTCT 4939 4881 + -2.55 TCTGCTTCTAAAGATGTTAT Branch points, complement strand -------------------------------- acceptor branch pos 5'->3' pos 5'->3' strand score 5' A 3' 3969 3990 - -1.19 CATATAACAAATCTTGACTC 823 850 - -1.12 TATTCATCAAAATATACTAT ------------------------------------------------------------------------------ CUTOFF values used for confidence: Highly confident donor sites (H): 95.0 % Nearly all true donor sites: 50.0 % Highly confident acceptor sites (H): 95.0 % Nearly all true acceptor sites: 20.0 % 

Graphics showing the prediction output

Direct strand ( + strand)








 
 

Complement strand ( - strand)







Graphics in postscript format

Direct Strand 29990 bytes.
Complement Strand 31562 bytes.

Prediction scores files

Direct Strand 47247 bytes.
Complement Strand 49721 bytes.